rAPOBEC1 (mammalian) (690 bp)
ATGAGCTCAGAGACTGGCCCAGTGGCTGTGGACCCCACATTGAGACGGCGGATCGAGCCCCATGAGTTTGAGGTATTCTTCGATCCGAGAGAGCTCCGCAAGGAGACCTGCCTGCTTTACGAAATTAATTGGGGGGGCCGGCACTCCATTTGGCGACATACATCACAGAACACTAACAAGCACGTCGAAGTCAACTTCATCGAGAAGTTCACGACAGAAAGATATTTCTGTCCGAACACAAGGTGCAGCATTACCTGGTTTCTCAGCTGGAGCCCATGCGGCGAATGTAGTAGGGCCATCACTGAATTCCTGTCAAGGTATCCCCACGTCACTCTGTTTATTTACATCGCAAGGCTGTACCACCACGCTGACCCCCGCAATCGACAAGGCCTGCGGGATTTGATCTCTTCAGGTGTGACTATCCAAATTATGACTGAGCAGGAGTCAGGATACTGCTGGAGAAACTTTGTGAATTATAGCCCGAGTAATGAAGCCCACTGGCCTAGGTATCCCCATCTGTGGGTACGACTGTACGTTCTTGAACTGTACTGCATCATACTGGGCCTGCCTCCTTGTCTCAACATTCTGAGAAGGAAGCAGCCACAGCTGACATTCTTTACCATCGCTCTTCAGTCTTGTCATTACCAGCGACTGCCCCCACACATTCTCTGGGCCACCGGGTTGAAATGA
Team:NUS Singapore-Sci/Editor Logbook
Editor System
Logbook
1) Removal of illegal BioBrick site in rAPOBEC
Gene for Rat APOBEC1 Deaminase Domain
We noted that there is the presence of an illegal biobrick site (GAATTC) from bases 504 to 509. As such, mutagenesis was conducted via PCR to mutate away a single base from GAATTC to GAGTTC. The mutation is conducted through multiple PCR reactions as shown in Figure 1 below. A total of five primers (refer to the primers document below) were designed to mutate away from the illegal site. The rAPOBEC template used for the PCR reactions was a kind gift from Dr. Alexis Komor and Dr. David Liu’s Laboratory.
| PCR Reaction | Template | Forward Primer | Reverse Primer |
|---|---|---|---|
| 1 | rAPOBEC | APOBEC F1 | APOBEC R1 |
| 2 | rAPOBEC | APOBEC F2 | APOBEC R2A |
| 3 | PCR product of PCR reaction 2 | APOBEC F2 | APOBEC R2B |
| 4 | PCR product of PCR reactions 1 & 3 | APOBEC F1 | APOBEC R2B |
Following agarose gel electrophoresis, a bright band near the 700 bp marker was present in lane 2, which indicates that rAPOBEC without the illegal biobrick site was successfully made (Figure 2).
Subsequently, the sample was then purified using a PCR purification kit and transformed into E. coli DH5α for plasmid isolation. The isolated plasmid was then sent for DNA sequencing (1st Base) using the primers VF2 and VR (refer to the primers document below) The sequencing results as shown in Figure 3 indicate that the mutation via PCR was successful, as the illegal EcoRI site was successfully mutated into GAGTTC.
2) Cloning of the rAPOBEC into pSB1C3 vector
To be able to insert F1R2B (rAPOBEC) into pSB1C3, both DNA have to be digested with the suitable restriction enzymes. F1R2B (rAPOBEC) and pSB1C3 were digested with XbaI and PstI-HF at 37°C for three hours and an agarose gel electrophoresis was done as shown in the results below (Figure 4). In lane 2 and 3, two bands of approximately 1500 bp and 900 bp were observed respectively, indicating the presence of digested pSB1C3. A single digestion of PstI-HF and Xbal was done on lane 4 and 5 respectively, showing a band between 2000 and 2500 bp and indicating the presence of linearised pSB1C3. Lane 6 shows a undigested pSB1C3 with a band between 2000 and 2500 bp.
Ligation was subsequently conducted using NEB T4 ligase in and incubated at 16°C overnight. Each of the reaction tubes were then transformed into E. coli DH5α and plated on LB agar with chloramphenicol plates and left to incubate at 37°C overnight. Colonies were only present on the agar plate with 1:3 (vector-to-insert) ratio. As such, four random colonies were picked and subjected to colony PCR using VF2 and VR primers to determine whether they contained the recombinant plasmid (Figure 5). Lanes 2 ,3 ,4 & 5 show a band between 700 and 1000 bp, indicating that the colonies picked all contain the recombinant plasmid.
The plasmids were isolated and sent for sequencing to confirm the presence of the entire rAPOBEC sequence in pSB1C3.
Cloning of rAPOBEC, BBa_K2083000 & BBa_K2083002 into pGEM-T Easy
rAPOBEC catalytic domain (F1R2B), BBa_K2083000 (APOBEC-XTEN) and BBa_K2083002 (APOBEC- 3XTEN) were cloned into pGEM-T Easy for in vitro expression (Figure 6). The pGEM-T Easy plasmid was chosen as it contained a T7 promoter, ampicillin resistance gene and suitable restriction sites for the restriction enzymes ApaI and PstI-HF (Figure 7).
As rAPOBEC does not contain the ApaI restriction site in the prefix, a forward primer (ApaI-FP) was designed to include the restriction site via PCR. PCR was conducted using the isolated rAPOBEC as a template with ApaI-FP as the forward primer and APOBEC R2B as the reverse primer. Agarose gel electrophoresis results of the PCR is as shown in Figure 8. The gel photo shows one band between 700 and 1000 bp each at lanes 2 and 3 which indicates a successful PCR reaction.
Similarly, as BBa_K2083000 and BBa_K2083002 do not contain the ApaI restriction site in the prefix, a forward primer (ApaI-FP BB Part) was designed to include the restriction site via PCR. The PCR was conducted using BBa_K2083000 and BBa_K2083002 from the iGEM Part Registry as a template with ApaI-FP BB Part as the forward primer and APOBEC R2B as the reverse primer. The gel results are as shown in Figure 9. The gel photo shows one band between 700 and 1000 bp each at lanes 2 and 3, indicating a successful PCR reaction.
The gene fragments and the pGEM-T Easy vector was then subjected to restriction digest at 16°C overnight with ApaI and PstI-HF enzymes to generate sticky ends. A positive control of pGEM-T Easy vector containing actin was also digested at the same time. Gel electrophoresis was subsequently conducted on the digested products to determine whether the restriction digest was successful (Figures 10 & Figure 11). In Figure 10, lane 2 shows a faint band around 700 bp, while lanes 3 and 4 shows a strong band around 3000 bp. Lane 4 also has another faint band at 1000 bp which indicates that restriction digest with ApaI and PstI-HF is a success, where actin is removed from the pGEM-T Easy vector backbone. In Figure 11, lanes 2 and 3 shows a faint band around 900 bp, while lanes 4 and 5 shows a strong band a faint band around 3000 bp.
Ligation was subsequently carried out at 16°C overnight with NEB T4 Ligase. The ligated products were then subsequently transformed into E. coli DH5α and plated on LB agar plates with ampicillin. There were colonies on all three plates with differing ligation ratios, albeit the most number of colonies were from 1:5, 1:3 and lastly, 1:1. This shows that 1:5 vector:insert ratio would be the most optimal ligation ratio between pGEMT-Easy vector as well as the 3 insert fragments, rAPOBEC, BBa_K2083000 and BBa_K2083002.
Four colonies each were randomly picked from 1:3 and 1:5 rAPOBEC plates respectively and a colony PCR was conducted to confirm whether the rAPOBEC catalytic domain was successfully ligated into the vector backbone (i.e. recombinant plasmid). Colony PCR was conducted using the same ApaI-FP and APOBEC R2B primers and gel electrophoresis was subsequently conducted on the PCR products with the results shown below (Figure 12). Lanes 4, 5, 6, 7, 8 and 9 all had a single strong band near 800 bp which indicates that the rAPOBEC catalytic domain was successfully cloned into the pGEM-T Easy vector.
Four colonies each were randomly picked from 1:3 and 1:5 rAPOBEC plates respectively and a colony PCR was conducted to confirm whether the rAPOBEC catalytic domain was successfully ligated into the vector backbone (i.e. recombinant plasmid). Colony PCR was conducted using the same ApaI-FP and APOBEC R2B primers and gel electrophoresis was subsequently conducted on the PCR products with the results shown below (Figure 12). Lanes 4, 5, 6, 7, 8 and 9 all had a single strong band near 800 bp which indicates that the rAPOBEC catalytic domain was successfully cloned into the pGEM-T Easy vector.
With regards to BBa_K2083000 and BBa_K2083002, two colonies were randomly picked for plasmid isolation. They were then subjected to restriction digest at 16°C overnight with ApaI and PstI-HF enzymes to generate sticky ends. Gel electrophoresis was then conducted on the digested products (Figure 13).
Sequencing was conducted on plasmid isolated from colonies 4 and 7 using ApaI-FP as the forward primer and APOBEC R2B as the reverse primer to confirm the presence of the rAPOBEC catalytic domain in pGEM-T Easy. Sequencing of the colonies for BBa_K2083000 and BBa_K2083002 were done using ApaI-FP BB Part and APOBEC R2B. The recombinant pGEM-T Easy plasmids were then subjected to in vitro expression and a deaminase assay was carried out.
4) Cloning of Cas13b and dCas13b into pSB1C3 vector
Both the plasmids, pC0049-EF1a-dPspCas13b-NES-HIV, H133A/H1058A and C0046-EF1a-PspCas13b-NES-HIV were kind gifts from Feng Zhang’s Laboratory (Addgene plasmids #103865 and #103862) and were obtained from Addgene. Cas13b is able to target and cleave messenger RNA strands with the aid of a compatible guide RNA, while the nuclease activity in deactivated Cas13b (dCas13b) has been inactivated through the mutation of the enzymatic catalytic sites. An inactivated form of Cas13b is important for our RESCUE editor as we aim to make a site-directed change rather than cleave the target strand.
PspCas13b and dPspCas13b were first amplified from Addgene plasmids 103862 and 103865 respectively using polymerase chain reaction (PCR). The insert comprises the PspCas13b gene with the inclusion of a nuclear export signal and a haemagglutinin (HA) tag at the C-terminus. The forward CasPSB XbaI FP and reverse CasPSB SpeI RP primers were designed to add XbaI and SpeI restriction sites to the PCR products for cloning into the pSB1C3 backbone. Then, the PCR products and pSB1C3 were restriction digested with the enzymes XbaI and SpeI for 2 hours prior to ligation. The digested PCR products were then ligated with the pSB1C3 backbone overnight and transformed into NEB Stable E. coli.
To confirm the presence of the Cas13b insert in the pSB1C3 plasmid, four colonies were selected from each of the pSB1C3-PspCas13b and pSB1C3-dPspCas13b transformation plates for plasmid isolation and restriction digest. The isolated plasmids were then subjected to XbaI and SpeI restriction digestion to cut the insert from the backbone before being analysed via agarose gel electrophoresis (Figure 14).
PspCas13b and dPspCas13b were first amplified from Addgene plasmids 103862 and 103865 respectively using polymerase chain reaction (PCR). The insert comprises the PspCas13b gene with the inclusion of a nuclear export signal and a haemagglutinin (HA) tag at the C-terminus. The forward CasPSB XbaI FP and reverse CasPSB SpeI RP primers were designed to add XbaI and SpeI restriction sites to the PCR products for cloning into the pSB1C3 backbone. Then, the PCR products and pSB1C3 were restriction digested with the enzymes XbaI and SpeI for 2 hours prior to ligation. The digested PCR products were then ligated with the pSB1C3 backbone overnight and transformed into NEB Stable E. coli.
To confirm the presence of the Cas13b insert in the pSB1C3 plasmid, four colonies were selected from each of the pSB1C3-PspCas13b and pSB1C3-dPspCas13b transformation plates for plasmid isolation and restriction digest. The isolated plasmids were then subjected to XbaI and SpeI restriction digestion to cut the insert from the backbone before being analysed via agarose gel electrophoresis (Figure 14).
Running the digested plasmids from these samples yielded a band at around 3400 bp in a DNA agarose gel as seen above in samples C3 and D3 (Figure 14). The approximate size for both PspCas13b and the dPspCas13b insert is 3400 bp in size while the linearized pSB1C3 plasmid is about 2000 bp in size.
As the original PspCas13b and dPspCas13b gene from the Addgene plasmids contained four BioBrick incompatible sites, it was necessary to mutate them. As C3 and D3 contained the desired insert, they were then subjected to Q5 Site-directed Mutagenesis.
For both PspCas13b and dPspCas13b, PstI sites at nucleotide base 237, 633, 1023, and 2445 were mutated from CTGCAG to CTTCAG. Primers for each round of Q5 mutagenesis are listed here. (hyperlink to primers list) Cycling parameters for each round of mutagenesis are listed in Table 2.
For both PspCas13b and dPspCas13b, PstI sites at nucleotide base 237, 633, 1023, and 2445 were mutated from CTGCAG to CTTCAG. Primers for each round of Q5 mutagenesis are listed here. (hyperlink to primers list) Cycling parameters for each round of mutagenesis are listed in Table 2.
| Temperature (℃) | Time (min) | Cycles | |
|---|---|---|---|
| Initial Denaturation | 98 | 0:30 | 1 |
| Denaturation | 98 | 0:10 | 25 |
The following document lists the primers used in the construction of the Editor System.