Team:OUC-China/Basic Part
Basic Parts
| Part number | Type | Description | Designer | Length（bp） |
|---|---|---|---|---|
| BBa_K2615020 | Regulatory | MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. | Yunqian Zhang | 68 |
| BBa_K2615013 | Coding | Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Yunqian Zhang | 564 |
| BBa_K2615014 | Coding | Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615015 | Coding | Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615016 | Coding | Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615021 | Regulatory | MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. | Anyi Li | 74 |
| BBa_K2615022 | Regulatory | MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. | Anyi Li | 74 |
| BBa_K2615023 | Regulatory | MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. | Anyi Li | 74 |
| BBa_K2615024 | Regulatory | MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. | Anyi Li | 74 |
| BBa_K2615025 | Regulatory | MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. | Yunqian Zhang | 74 |
Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved.
