Team:FSU/Human Practices
Local Breweries
HP interviewed the lead brewer, David Kant-Rauch, at Proof Brewing Company located in Tallahassee, Florida. We learned that a concern in brewing occurs during the anaerobic phase when the yeast cells are eating the byproducts created during the aerobic phase of the brewing process. These byproducts, such as phenols and esters, cause distinct flavors in the brew when the fermentation process is completed. Mr. Kant-Rauch explained if we could control the inhibition or expression of certain byproducts, this would revolutionize the brewing industry.
One strain of yeast produces one type of beer, which can become a large financial burden for breweries to maintain and produce numerous beers. It was found if our E. coli prototype could be stimulated to produce different chemicals at different sound frequencies, this device could be transferred into yeast to improve the brewing industry. If a single strain of yeast could then be modified to produce multiple types of beer at different sound frequencies, this would drastically cut costs for breweries by preventing the unnecessary expense of housing several yeast strains. This would also allow the brewmaster to have much greater control over the flavor of beer by being able to regulate the various compounds produced by the sound activated yeast.
Molecular Biology
Mixers
In our lab we used the VWR mixer to stimulate our E. coli cells. Our project focuses on sound as a way to stimulate cells to induce a response which led HP to consider the device which stimulates our cells currently. Adding a way to have a specific amplitude and frequency played with the mixer rather than using a chemical to stimulate the cells lower costs and advance the equipment.
Marketing and Impact
The FSU lab where our project was completed has about seven mixers alone. Other labs are also within the building and they have multiple mixers as well. Based on this data and the knowledge of companies, such as VWR and Eppendorf, selling their mixers internationally, adding sound as a new stimulation to a mixer would increase profits to mixer companies as well as save research labs funds over time because they no longer need to buy stimulus chemicals.
Florida Department of Law Enforcement
FDLE Interview
Many products, such as cotton, are watermarked in order for companies to trace the cotton back to the company, down to the bale number (Applied DNA Sciences, 2018). A watermark on the DNA strand or plasmid works like a barcode on a product at a store or a signature. The watermark allows buyers and sellers to be sure of the authenticity of their product. Our watermark would function the same way. Most biological watermarks are located in a noncoding region of the plasmid, however, when watermarks are placed in coding regions they are crafted so they do not change the amino acid sequence or DNA function.
After interviewing John Gonzalez, a member of the evidence lab at FDLE, we added a new part to the design of our plasmid. It was brought up to Mr. Gonzalez our project had the potential to be a biological threat and he agreed. During the interview, he explained a watermark could be one way to mitigate the negative effects of the plasmid, should they arise. Using the watermark would work as though FSU 2018 left a signature or branding on the plasmid so it could be traced back to us.
Sound as a Weapon
Sound being used a warning is not new, some believe this could be related to evolution in humans to detect events such as natural disasters like earthquakes and predators such as tigers (Mysterious Universe, 2018). Sound has been weaponized in the past, armed forces have begun testing weaponized sound via Long Range Acoustic Devices (LRADs) and other sound producing devices. They have also deployed some of these devices during a 2014 protest in Manhattan (Moynihan, 2018). During this protest, people experienced loud, high pitched sounds produced by an LRAD. This incident would ultimately lead to a lawsuit challenging the police on whether it was necessary to use sound as a weapon since it caused people migraines, hearing loss, and dizziness (Moynihan, 2017).
Recent news reports claim microwaves could have been used in an attack on United States diplomats in both Cuba and China. According to an article by CNN, the attacks occurred mostly during 2016 and 2017 (McLaughlin and Labott, 2018). The diplomats who were in the buildings were medically evaluated. Many were found to have suffered brain injuries which investigators believe is due to extensive microwave exposure (McLaughlin and Labott, 2018). In China, diplomats had a similar experience in hearing buzzing noises and feeling pressure within their head (Nedelman, 2018).
Biological Warfare
This information led the HP team down a new route for how our system could be used in a harmful way. Since our cells are designed to be stimulated by sound, they could become a latent weapon in the wrong hands. Consider this scenario: At a meeting with important diplomats from around the world, an assassin with a nonpathogenic strain of bacteria shakes hands with a diplomat. As the diplomat leaves and returns to their hotel room with their hand contaminated by the bacteria. The assassin would then take an antidote or cleanse their skin of the bacteria as to not infect their own body. The assassin then plays a specific frequency toward the hotel room where the diplomat resides, inducing the bacteria to become pathogenic and produce a toxin that can seep through the skin. The diplomat soon passes away due to the toxin and investigators are puzzled as to how it was ingested. Tracking down the assassin would be very difficult.
This example may seem far-fetched to some, but an attack on an ex-Russian spy in England is very similar. According to a CNBC, the ex-spy and his daughter were poisoned by a neurotoxin placed on the doorknob of their home. The neurotoxin used during the attack was Novichok (CNBC, 2018). Another attack was done using the same toxin through the use of a perfume bottle where the woman who applied the perfume passed away from the toxic (Morris and Rawlinson, 2018). While this example lacked the cell to be activated via sound in order to produce the toxin, it is very close to the scenario investigated by HP.
History of the Watermark
The application of watermarks can be traced back to the 13th century in Italy (Encyclopedia Britannica, 2018). There are a wide variety of styles and types of watermarks. It is thought watermarks were a way for people to gauge the quality and size of the paper (Tyree, 2018). Papermakers would use watermarks as invisible signatures or trademarks to protect their craftsmanship (Tyree, 2018). Watermarks are still in use today, one of the most widely known watermarks occurs on paper currency. The watermark on paper currency is easily seen when held up to a light source and is used to help reduce counterfeiting.
Our Watermark
Our watermark is located upstream of the promoter in a noncoding region of the DNA plasmid. It spells out “fsuigem” in binary when translated from its nucleotide sequence using Twist Bioscience methods. Twist Bioscience methods changes DNA coding into a binary sequence. Our watermark serves as a signature and a way the plasmid can later be traced back to us. The sequence of our watermark is "GCGCGTATGTGGGCCGGCGTGCGGGCTG"
Pros & Cons of a Watermark
DNA watermarks could be stored in a database which would be used to trace the sequence back to the original creator. If the sequence does not have a watermark it can be quarantined to prevent potential infections while the owner of the sequence is being traced. If a sequence is found to be pathogenic and has a watermark it can also be traced back to the creator.
A potential con of having the watermark on the DNA is it can easily be cleaved off the sequence. Since the watermark typically serves no functional purpose other than linking the genetic information back to the creator, it can be removed and the DNA will still work properly. If a watermark can be removed from a DNA sequence, it is also reasonable to assume when it is removed the watermark could be attached to another sequence. This can lead to people being held accountable for potentially pathogenic sequences they did not create.