Team:IISc-Bangalore/Assembly

Assembly

The following are all the different methods of cloning we used for all the different parts used in our project.

Assembly 1: pSB1C3 Method

Assembled Parts

The following fragments were orderd from IDT.

mcp-1 under T7 expression system
The mcp-1 gene sequence, fused to a 6xHis tag linked by a TEV Protease site, under a T7 expression system i.e. T7 promoter and RBS and T7 Terminator.


mcp-1+HlyA in T4 recombination cassette
The mcp-1 gene sequence fused to HlyA signal peptide and linker by an OmpT linker on the C terminus, inside a T4 recombination cassette i.e. flanked by regions homologous to flanking regions of Endolysin on T4.

mcp-1+PelB in T4 recombination cassette
The mcp-1 gene sequence fused to PelB signal peptide on the N terminus, inside a T4 recombination cassette.

T4 Endolysin under constitutive promoter
The T4 Endolysin gene sequence, under a constitutive expression system with BBa_J23106, a constitutive promoter and RBS and B0015 double terminator.

gp37-M1,M2,M3,M4 under T7 expression system
Modified T4 long tail fibre protein gp37 under the T7 expression system.

imCherry under T7 expression system
Modified imCherry sequence (831 bp) under a T7 expression system, with a 6xHis tag.

PCR

The above mentioned sequences ordered from IDT were amplified using the following primers:
Forward Primer: ggtggtgaattcgcggccgcttctagag
Reverse Primer: ggtggtctgcagcggccgctact

Restriction Digest

Fragments were digested with EcoRI and PstI, along with the pSB1C3 backbone obtained as a part of the iGEM kit.

Ligation

Digested fragments and pSB1C3 were ligated and transformed into DH5α.

Screening & Verification

Colony PCR
Following transformation, presence of insert was verified through a colony PCR with appropriate primers. (VF2/VR)

Miniprep and digest
Following this, a plasmid preparation was performed, and a digestion of this prepared plasmid DNA with EcoRI and PstI was used to verify the presence of insert of appropriate size.

This was further verified by DNA sequencing.
We were successful in assembling almost all of the above parts.
We tried the above method to assemble gp37 mutated sequences but were successful in cloning only gp37 M2, even after multiple trials.

Protein Expression

For the parts under the T7 expression system, the isolated plasmid was transformed into E coli BL21 (DE3), and the cultures induced with 500μM IPTG at OD600 = 0.6, to allow the expression of the protein. SDS-PAGE was performed to verify the production of protein. For T4 Endolysin, no induction was needed as it is under a constitutive promoter. Endolysin was transformed into E coli BL21 (DE3) and after growing for 6 hours, the culture was loaded onto an SDS PAGE and compared with that of Wild Type E coli BL21 (DE3).

Assembly 2: T7 Adapter Method

PCR

The following fragments were amplified and HindIII and NheI restriction sites were added using extension PCR:

  • mcp-1+HlyA in T4 recombination cassette
  • mcp-1+PelB in T4 recombination cassette
  • BBa_K1433005 - Lambda RED recombination genes

T7 Expression Adapter

The T7 adapter is a linearised backbone constructed from pSB1C3. It contains T7 promoter and RBS upstream and T7 Terminator downstream of the insert region. It contains HindIII and NheI restriction sites for easy cloning of the insert. The T7 adapter was obtained from the assembled mcp-1 under T7 expression system plasmid by restriction digestion with HindIII and NheI followed by gel extraction.

Digestion & Ligation

PCR-ed fragments were digested with HindIII and NheI and ligated with the T7 Adapter.

Screening & Verification

Colony PCR
Colonies for Lambda RED were colony PCR-ed with appropriate primers.

Miniprep and digest
Positive colonies from colony PCR were miniprepped and the restriction digested with EcoRI, PstI, HindIII and NheI and visualised on an agarose gel.

Backbone Change

Lambda RED under T7 expression
Miniprep of Lambda RED under T7 expression system plasmid under a pSB1C3 T7 adapter (CamR) and pSB1A3 (AmpR) linearized backbone from the iGEM kit were digested with EcoRI and PstI and ligated. This was transformed into DH5α and plated on an Ampicillin plate.

We were successful in assembling all three parts using the above method.

Protein Expression

Positive and verified plasmids of each part were transformed into E. coli BL21(DE3) and expressed by induction with IPTG.

Bands were observed slightly below 32kDa ladder band and at the 25kDa ladder band. These two correspond to the bet protein (29.7 kDa) and the exo protein (25.9 kDa). The other protein - gam (16.3 kDa) - could be seen on the gel.

Assembly 3: T7 Adapter + Oligo Method

Assembly of imCherry under T7 expression system

PCR

The BioBrick, BBa_J18932 (mCherry RFP construct) was suitably PCRed to add the NheI site at the C term.

Digestion

An ordered oligonucleotide sequence, with a 6xHis tag, and the initial portion of the modified mCherry sequence, flanked by the HindIII and NdeI site, was digested with the above-mentioned enzymes. The above mentioned PCR-ed fragment was digested with NdeI and NheI.
The BioBrick, BBa _K2319009 (mCherry under the T7 expression system) designed by the iGEM IISc 2017 team, following digestion with HindIII and NheI was utilised as the T7 adapter backbone.

Ligation

The three fragments were then ligated in a three way ligation. We believed this ligation would yield the required construct.

After transforming the above ligation into DH5α, transformants were miniprepped for plasmid and digested for verification. After multiple trials, we were unable to obtain a plasmid that showed correct digest bands. So, we instead ordered the whole modified imCherry sequence fused with an N term 6xHis tag inside a T7 Expression System and flanked by BioBrick Prefix and Suffix from IDT. We then followed Method 1 - The pSB1C3 Method and were successful in assembly.