SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
Line 123: | Line 123: | ||
</div> | </div> | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
<center> | <center> | ||
<br> | <br> | ||
</br> | </br> | ||
− | <div style = 'text-indent: px; padding-right: 190px; padding-left: 190px;'> For our full safety page please click <a href=" | + | <div style = 'text-indent: px; padding-right: 190px; padding-left: 190px;'> For our full safety page please click <a href=" |
+ | |||
+ | ">here</a>. | ||
</div> | </div> | ||
</center> | </center> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
Revision as of 08:25, 2 October 2018
Safety
1) Safe project design
Basic Parts
Composite Parts
2) Safe lab work
primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Safe shipment
3-1 Kit
Name | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Link
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
For our full safety page please click here.