SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
Line 74: | Line 74: | ||
<!-----------------------------------------------------BLOCK Safe project design--------------------------------------------------------------> | <!-----------------------------------------------------BLOCK Safe project design--------------------------------------------------------------> | ||
<h5 id="Safe project design">1) Safe project design</h5> | <h5 id="Safe project design">1) Safe project design</h5> | ||
− | < | + | <p>All of the species we expect to use are not harmful for human.</p> |
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | <h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | ||
<!-----------------------------------------------------BLOCK Safe project design END----------------------------------------------------------> | <!-----------------------------------------------------BLOCK Safe project design END----------------------------------------------------------> |
Revision as of 08:27, 2 October 2018
Safety
1) Safe project design
All of the species we expect to use are not harmful for human.
Composite Parts
2) Safe lab work
primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Safe shipment
3-1 Kit
Name | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Link
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
For our full safety page please click here.