Difference between revisions of "Team:Kyoto/Safety"

Line 74: Line 74:
 
<!-----------------------------------------------------BLOCK Safe project design-------------------------------------------------------------->
 
<!-----------------------------------------------------BLOCK Safe project design-------------------------------------------------------------->
 
<h5 id="Safe project design">1) Safe project design</h5>
 
<h5 id="Safe project design">1) Safe project design</h5>
<p>All of the species we expect to use are not harmful for human.</p>
+
<p><font size="3">All of the species we expect to use are not harmful for human.</font></p>
<font size="6">All of the species we expect to use are not harmful for human.</font>
+
<font size="3">All of the species we expect to use are not harmful for human.</font>
  
 
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6>
 
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6>

Revision as of 08:32, 2 October 2018

Safety






1) Safe project design

All of the species we expect to use are not harmful for human.

All of the species we expect to use are not harmful for human.
Composite Parts
2) Safe lab work
primer namesequenceLengthTmGC%DesignerManufacturer
tropomyosinFGATCGAGAAGGACAACGCCC206560FukudaMacrogen Japan Corp
IK107cccgccgccaccatggaggcggccgcaaaatcagg359471YoshimotoMacrogen Japan Corp
3) Safe shipment
3-1 Kit
NameSupplier
Wizard® SV Gel and PCRPromega
FastGene™Plasmid Mini KitNIPPON Genetics Co.,Ltd
4-1 Miniprep

Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

4-17 Soaking

We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf





For our full safety page please click here.