Difference between revisions of "Team:JMU Wuerzburg/Basic Part"

Line 1: Line 1:
 +
{{JMU_Wuerzburg/jmu_wuerzburg_css}}
 +
{{JMU_Wuerzburg/jmu_wuerzburg_jquery-3.3.1.min.js}}
 +
{{JMU_Wuerzburg/jmu_wuerzburg_jquery-ui.min.js}}
 
{{JMU_Wuerzburg}}
 
{{JMU_Wuerzburg}}
 +
 
<html>
 
<html>
  
  
 +
<div class="content">
 +
            <h3>Part BBa_K2614000</h3>
 +
            <div>
 +
                We developed a primer/probe set for a qPCR, which detects the human pathogens of the genus Plasmodium. This part can be used as positive control for our qPCR.
 +
                If you like to run this qPCR you need one sense primer (CTGGCTAAACTTCCCAATGA), one antisense primer (GTCTATATTCATGTTTGATTGACCTT) and a dual labeled Probe ([6FAM]CTTcCAaATaGAtTTCGCAGAA[BHQ1] (lowercase letter = LNA)).
  
 +
                <div style="border-style: solid; border-color: #CCC; border-width: 1px; margin: 2em auto; width: 80%;">
 +
                    <img style="width: 100%;" src="src/pics/BBa_K2614000_qPCR_Plasmodium2.png" alt="fehlt" style="display: block;">
 +
                    <span style="text-decoration: underline;"></span> qPCR with primer/probe set for Plasmodium in general. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
 +
                </div>
  
−
<div class="column full_size">
+
                <div style="border-style: solid; border-color: #CCC; border-width: 1px; margin: 2em auto; width: 80%;">
−
<h1>Basic Parts</h1>
+
                    <img style="width: 100%;" src="src/pics/BBa_K2614000_qPCR_multiplex2.png" alt="fehlt" style="display: block;">  
−
<p>
+
                    <span style="text-decoration: underline;"></span> Multiplex qPCR with primer/probe set for Plasmodium in general and Plasmodium falciparum. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
−
A <b>basic part</b> is a functional unit of DNA that cannot be subdivided into smaller component parts. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_R0051">BBa_R0051</a> is an example of a basic part, a promoter regulated by lambda cl.
+
                </div>
−
</p>
+
            </div>
−
 
+
        </div>
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are <b>many</b> opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. </p>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="column full_size">
+
−
<div class="highlight decoration_background">
+
−
<h3>Note</h3>
+
−
<p>This page should list all the basic parts your team has made during your project. You must add all characterization information for your parts on the Registry. You should not put characterization information on this page. Remember judges will only look at the first part in the list for the Best Basic Part award, so put your best part first!</p>
+
−
</div>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="column full_size">
+
−
<h3>Best Basic Part Special Prize</h3>
+
−
 
+
−
<p> To be eligible for this award, this part must adhere to <a href="http://parts.igem.org/DNA_Submission">Registry sample submission guidelines</a> and have been sent to the Registry of Standard Biological Parts. If you have a part you wish to nominate your team for this <a href="https://2018.igem.org/Judging/Awards">special prize</a>, make sure you add your part number to your <a href="https://2018.igem.org/Judging/Judging_Form">judging form</a> and delete the box at the top of this page.
+
−
 
+
−
<br><br>
+
−
<b>Please note:</b> Judges will only look at the first part number you list, so please only enter ONE (1) part number in the judging form for this prize. </p>
+
−
</div>
+
−
 
+
  
  

Revision as of 00:18, 17 October 2018

Part BBa_K2614000

We developed a primer/probe set for a qPCR, which detects the human pathogens of the genus Plasmodium. This part can be used as positive control for our qPCR. If you like to run this qPCR you need one sense primer (CTGGCTAAACTTCCCAATGA), one antisense primer (GTCTATATTCATGTTTGATTGACCTT) and a dual labeled Probe ([6FAM]CTTcCAaATaGAtTTCGCAGAA[BHQ1] (lowercase letter = LNA)).
fehlt qPCR with primer/probe set for Plasmodium in general. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
fehlt Multiplex qPCR with primer/probe set for Plasmodium in general and Plasmodium falciparum. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.