Difference between revisions of "Team:ZJU-China/Improve"

 
(25 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
<html lang="en">
 
<html lang="en">
 
<head>
 
<head>
<style type="text/css">
 
 
 
 
</style>
 
 
<meta charset="{CHARSET}">
 
<meta charset="{CHARSET}">
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapCSS&action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapCSS&action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/pageCSS&action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/pageCSS&action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/subtitleCSS&action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/sponsorCSS&action=raw&ctype=text/css" />
 
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/sponsorCSS&action=raw&ctype=text/css" />
 
<script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapJS&action=raw&ctype=text/javascript"></script>
 
<script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapJS&action=raw&ctype=text/javascript"></script>
Line 18: Line 14:
  
 
<style type="text/css">
 
<style type="text/css">
 +
 +
@font-face {
 +
font-family: Julius Sans One;
 +
src: url(https://static.igem.org/mediawiki/2018/6/61/T--ZJU-China--cotham.otf) format('truetype');
 +
}
 +
 +
.nav > li > a, .dropdown-toggle, .dropdown-menu > li > a {
 +
font-family: 'Julius Sans One', sans-serif !important;
 +
}
 +
td, th {
 +
font-size: .8em !important
 +
}
 
.dropdown-menu > li > a {
 
.dropdown-menu > li > a {
 
font-size: .5em !important;
 
font-size: .5em !important;
Line 131: Line 139:
 
font-weight: 500;
 
font-weight: 500;
 
position: absolute;
 
position: absolute;
top: 35%;
+
top: 31.6%;
 
right: 10%;
 
right: 10%;
 
transition: all 0.4s ease 0s;
 
transition: all 0.4s ease 0s;
Line 154: Line 162:
 
}
 
}
 
@media only screen and (max-width:990px){
 
@media only screen and (max-width:990px){
 +
.igem_content_wrapper {
 +
    width: 200% !important;
 +
}
 +
 +
.igem_2018_team_content {
 +
width: 200% !important;
 +
}
 +
 +
.cnt {
 +
margin-left: -3em !important;
 +
}
 +
 +
.tl {
 +
margin-left:-2em !important;
 +
}
 +
 +
.tl:after {
 +
margin-left:0 !important;
 +
}
 +
 +
.navbar-toggle {
 +
margin-left: 80% !important;
 +
}
 
nav.navbar.bootsnav ul.nav > li.dropdown > a.dropdown-toggle:after,
 
nav.navbar.bootsnav ul.nav > li.dropdown > a.dropdown-toggle:after,
 
nav.navbar.bootsnav ul.nav > li.dropdown.on > a.dropdown-toggle:after{ content: " "; }
 
nav.navbar.bootsnav ul.nav > li.dropdown.on > a.dropdown-toggle:after{ content: " "; }
Line 211: Line 242:
 
<body>
 
<body>
  
<div class="demo" style="width: 100%; padding: 0em 0; position: fixed; margin: 0; left:0; top: 0; z-index: 999; font-size: .8em !important">
+
<div class="demo" style="width: 100%; padding: 0em 0; position: fixed; margin: 0; left:0; top: 0; z-index: 999; font-size: 1em !important">
 
<div class="container">
 
<div class="container">
 
<div class="row">
 
<div class="row">
Line 217: Line 248:
 
<nav class="navbar navbar-default navbar-mobile bootsnav">
 
<nav class="navbar navbar-default navbar-mobile bootsnav">
 
<div class="navbar-header">
 
<div class="navbar-header">
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#navbar-menu">
+
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#navbar-menu">menu
 
<i class="fa fa-bars"></i>
 
<i class="fa fa-bars"></i>
 
</button>
 
</button>
Line 225: Line 256:
 
padding: 0; border: #000000 solid 1px;"></div>-->
 
padding: 0; border: #000000 solid 1px;"></div>-->
 
<ul class="nav navbar-nav" data-in="fadeInDown" data-out="fadeOutUp">
 
<ul class="nav navbar-nav" data-in="fadeInDown" data-out="fadeOutUp">
<li class="logo"><a href="#">
+
<li class="logo"><a href="https://2018.igem.org/Team:ZJU-China">
 
<!--<img src="url(img/logo.png)" />-->
 
<!--<img src="url(img/logo.png)" />-->
 
</a></li>
 
</a></li>
Line 231: Line 262:
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project</a>
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project</a>
 
<ul class="dropdown-menu">
 
<ul class="dropdown-menu">
<li><a href="#">Description</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Demonstrate">Demonstrate</a></li>
<li class="dropdown">
+
<li><a href="https://2018.igem.org/Team:ZJU-China/EnzymeScaffold">Enzyme Scaffold</a></li>
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Design&Results</a>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/LogicGate">Logic Gate</a></li>
<ul class="dropdown-menu">
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Matrix">Matrix</a></li>
<li><a href="#">Curli</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Electrodes">Electrodes</a></li>
<li><a href="#">Tag/Catcher System</a></li>
+
 
<li><a href="#">Enzyme</a></li>
+
<li><a href="#">Logic Gate</a></li>
+
</ul>
+
</li>
+
<li class="dropdown">
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Applied Design</a>
+
<ul class="dropdown-menu">
+
<li><a href="#">Overview</a></li>
+
<li><a href="#">2D print</a></li>
+
<li><a href="#">Electrode</a></li>
+
<li><a href="#">Integration</a></li>
+
<li><a href="#">Roll-out Plan</a></li>
+
</ul>
+
</li>
+
 
</ul>
 
</ul>
 
</li>
 
</li>
 
<li class="dropdown">
 
<li class="dropdown">
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Parts</a>
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Applied Design</a>
 
<ul class="dropdown-menu">
 
<ul class="dropdown-menu">
<li><a href="#">Overview</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Applied_Design">Product Design</a></li>
<li><a href="#">Basic Parts</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Hardware">Hardware</a></li>
<li><a href="#">Composite Parts</a></li>
+
 
<li><a href="#">Improved Parts</a></li>
+
 
</ul>
+
</li>
+
<li><a href="#">Modeling</a></li>
+
<li><a href="#">InterLab</a></li>
+
<li class="dropdown">
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Safety</a>
+
<ul class="dropdown-menu">
+
<li><a href="#">Project Safety</a></li>
+
<li><a href="#">General Safety</a></li>
+
 
</ul>
 
</ul>
 
</li>
 
</li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Model">Model</a></li>
 
<li class="dropdown" style="min-width: 250px;">
 
<li class="dropdown" style="min-width: 250px;">
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Human Practice</a>
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Human Practice</a>
 
<ul class="dropdown-menu">
 
<ul class="dropdown-menu">
<li class="dropdown">
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Silver</a>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Human_Practices" class="dropdown-toggle" data-toggle="dropdown" >Silver&Gold</a></li>
<ul class="dropdown-menu">
+
<li><a href="#">TED Talk</a></li>
+
<li><a href="#">Subscriptions</a></li>
+
</ul>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Public_Engagement" class="dropdown-toggle" data-toggle="dropdown" >Public Engagement</a>
 +
 
</li>
 
</li>
<li class="dropdown">
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Gold Integrated</a>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Collaborations">Collaborations</a></li>
<ul class="dropdown-menu">
+
<li><a href="#">Academics</a></li>
+
<li><a href="#">Hospitals</a></li>
+
<li><a href="#">Bioethics</a></li>
+
</ul>
+
</li>
+
<li class="dropdown">
+
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Education & Public Engagement</a>
+
<ul class="dropdown-menu">
+
<li><a href="#">Science Museum</a></li>
+
<li><a href="#">Bioart Exhibition</a></li>
+
</ul>
+
</li>
+
<li><a href="#">Collaborations</a></li>
+
 
</ul>
 
</ul>
 
</li>
 
</li>
 
<li class="dropdown">
 
<li class="dropdown">
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Notebook</a>
+
 
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Parts</a>
 
<ul class="dropdown-menu">
 
<ul class="dropdown-menu">
<li><a href="#">Lab Book</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/AllParts">All parts</a></li>
<li><a href="#">Protocols</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/BasicPart">Basic Parts</a></li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/CompositePart
 +
">Composite Parts</a></li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Collection">Collection</a></li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Improve">Improved Parts</a></li>
 
</ul>
 
</ul>
 
</li>
 
</li>
 +
 +
 
<li class="dropdown">
 
<li class="dropdown">
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Team</a>
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Team</a>
<ul class="dropdown-menu">
+
<ul class="dropdown-menu">
<li><a href="#">Members</a></li>
+
<li class="dropdown">
<li><a href="#">Attribution</a></li>
+
 
<li><a href="#">Contributions</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Team">Members</a></li>
<li><a href="#">Sponsors</a></li>
+
<li><a href="https://2018.igem.org/Team:ZJU-China/Attributions">Attributions</a></li>
 +
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Notebook</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Notebook">Lab book</a></li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Protocols">Protocols</a></li>
 +
</ul>
 +
</li>
 +
</ul>
 +
</li>
 +
 +
 
 +
 +
 
 +
 +
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/InterLab">InterLab</a></li>
 +
<li><a href="https://2018.igem.org/Team:ZJU-China/Safety" class="dropdown-toggle" data-toggle="dropdown">Safety</a></li>
 +
 +
 +
 
<!--<li class="dropdown">
 
<!--<li class="dropdown">
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Sub Menu</a>
 
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Sub Menu</a>
Line 392: Line 418:
 
</table>
 
</table>
 
<span class="psg_ttl">Test</span>
 
<span class="psg_ttl">Test</span>
<p>To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.</p>
+
<p>To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the <i>E.coli</i> BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.</p>
 
<img src="https://static.igem.org/mediawiki/2018/5/54/T--ZJU-China--ip01.png" style="width: 80%;"/>
 
<img src="https://static.igem.org/mediawiki/2018/5/54/T--ZJU-China--ip01.png" style="width: 80%;"/>
 
<h5>Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters</h5>
 
<h5>Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters</h5>

Latest revision as of 00:19, 18 October 2018

Improve Part
IMPOROVE PART 
OVERVIEW 

Currently, T7 promoter is one of the most widely used promoters for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter has proven quite effective, in some cases, we need modified T7 promoters with even higher efficiency of protein expression to meet specific demands. Hence, we tried to transform the wild-type T7 promoter to get modified T7 promoters with increased strength .


T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some point mutations between positions -11 and -7 may make T7 promoter fail to work. Thus, with the help of previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -4 to +6. The sequences of these modified promoters are shown in the Table below.



Sequences of Modified Promoters
Part Number Sequence(-17~+6)
BBa_R0085(wild type) TAATACGACTCACTATAGGGAGA
BBa_K2721000 TAATACGACTCACTATCGCGGAG
BBa_K2721001 TAATACGACTCACTCCAGCAATC
BBa_K2721002 TAATACGACTCACTTCAGCGACC
BBa_K2721003 TAATACGACTCACACGAGCGAGA
Test

To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.

Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters
Part Number Relative Strength
BBa_R0085(wild type) 1
BBa_K2721000 20.99
BBa_K2721001 17.75
BBa_K2721002 7.63
BBa_K2721003 13.92


As we can see from the figure, our mutant promoters showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoters offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.

References

[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.

[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.