Difference between revisions of "Team:Kyoto/Safety"

Line 123: Line 123:
 
       </div>
 
       </div>
 
   </div>
 
   </div>
<div style = 'padding-right: 190px; padding-left: 190px;line-height: 30px; text-indent: 50px;' >Our project is foundational and therefore we do not have a specific real-world application. For that reason, our project poses no risks in the real world. In terms of ethical risks, these are minimal to non-existent given that we do not plan to use animals or introduce anything into the environment. Since we are doing foundational research, all our experiments will be conducted in the lab with the goal of providing additional knowledge about the role of protein degradation and the speed of reactions in genetic circuits.</div>
 
<div style='padding-top: 150px;'></div>
 
</div>
 
 
<center>
 
<center>
 
<br>
 
<br>
 
</br>
 
</br>
<div style = 'text-indent: px; padding-right: 190px; padding-left: 190px;'> For our full safety page please click <a href="https://2017.igem.org/Safety/Final_Safety_Form">here</a>.
+
<div style = 'text-indent: px; padding-right: 190px; padding-left: 190px;'> For our full safety page please click <a href="
 +
 
 +
">here</a>.
 
</div>
 
</div>
 
</center>
 
</center>
<center>
 
<div style='padding-top: 50px;'></div>
 
<img src="https://static.igem.org/mediawiki/2017/b/bc/T--William_and_Mary--Safetylab2.jpeg" style= "margin:25px;" height = "25%" width = "25%" />
 
<img src="https://static.igem.org/mediawiki/2017/3/3b/T--William_and_Mary--SafetyLab3.jpeg" height = "25%" width = "25%"/>
 
</center>
 
 
 
  
  

Revision as of 08:25, 2 October 2018

Safety






1) Safe project design
Basic Parts
Composite Parts
2) Safe lab work
primer namesequenceLengthTmGC%DesignerManufacturer
tropomyosinFGATCGAGAAGGACAACGCCC206560FukudaMacrogen Japan Corp
IK107cccgccgccaccatggaggcggccgcaaaatcagg359471YoshimotoMacrogen Japan Corp
3) Safe shipment
3-1 Kit
NameSupplier
Wizard® SV Gel and PCRPromega
FastGene™Plasmid Mini KitNIPPON Genetics Co.,Ltd
4-1 Miniprep

Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

4-17 Soaking

We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf





For our full safety page please click here.