21/08/18

Lorenzo

1/9M (RFP) was transformed from the iGEM kit according to the protocol. The coding sequence of the custom receptor, and copper promoter flanked by biobrick sites were ordered from IDT and used directly.

22/08/18

Lorenzo

Transformation was successful and a colony was picked and inoculated in chloramphenicol.

23/08/18

Felix, Lorenzo

Miniprep was performed according to the protocol.
Cu-promotor → 250 ng/μl
Custom receptor → 360 ng/μl
RFP → 91.7 ng/μl

Cu-promoter and RFP were placed in pSB1K3, custom receptor was placed in pSB1K3 as well. Cu-promoter DNA was digested with EcoRI and SpeI, RFP DNA was digested with XbaI and PstI. The custom receptor and the target-vector were digested with EcoRI and PstI.

For each of the three samples a mastermix was made. For each digestion the DNA concentration was reduced to 25 ng/ul. 4 ul of DNA sample and target vector sample were transferred to a PCR tube with 4 ul of the according restriction mix. The samples were incubated for 1 hour at 37 C. After 1 hour the samples were taken out of the incubator and enzymes were heat deactivated at 80°C for 20 min. 1ul of target vector (pSB1K3), 2 ul of Cu-promotor restricted DNA, and 2 ul restricted RFP DNA were added to one PCR tube. Furthermore 1ul DNA T4 ligase buffer and 0.5 ul of T4 ligase were added. The total volume was made up to 10 ul with 3.5 ul dH2O. The samples were incubated for one hour (RT). Enzymes were deactivated with heat kill 80°C 20 min.

DNA was transformed in DH5α according to the iGEM protocol.

24/08/18

Lorenzo

The transformation was successful. 8 colonies were picked to perform colony PCR according to the protocol. (Cu-promotor::RFP 100%, Cu-promotor::RFP 500%, Custom receptor 100%, Custom Receptor 500%).

Note: The date on the plates is date of preparation not transformation

27/08/18

Felix

Samples from colony PCR (24/08/18) were analysed with a 0.8% Agar gel electrophoresis.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

1-8	Custom receptor 100%
9-16	Custom receptor 500%
17-24	Cu::RFP 100%
25-32	Cu::RFP 500%

28/08/18

Lorenzo, Felix

The results obtained in the gel electrophoresis DNA analysis (27/8/18) was not satisfactory. Therefore four new colonies were picked for colony PCR in accordance with the protocol.

1-4	Cu::RFP 100%
5-8	Cu::RFP 500%
9-12	Custom receptor 100%
13-16	Custom receptor 500%

The PCR samples were analysed with gel electrophoresis using 0.8% agarose gel.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

Samples 4, 9, 12, 13, 14 were selected and inoculated in 5 ml LB containing kanamycin overnight. A safe of these samples was made as well.

As the Cu::RFP sample did not yield the desired results, new cloning procedure was initiated using the iGEM protocol and buffer 2.1 instead of enzyme specific buffers. In order to ensure that we would have enough genetic material, we cloned the gBlock `copper-promoter blunt into the vector pBSK.

29/08/18

Felix

The DNA of the (28/08/18) samples was purified according to the miniprep protocol.

Sample	Concentration ng/µl	Description
1 - 8	69.9	Cu-Promotor+ RFP
9	77.5	Custom Receptor
12	91.8	Custom Receptor
13	49.4	Custom Receptor
14	85.4	Custom Receptor

The prior prepared clonation (28/08/18) was transformed in DH5α according to the iGEM protocol.

Safe made from samples Samples 4, 9, 12, 13, 14 (08/28/18)

30/08/18

Felix

No colonies of the transformation(29/8/18) were observed.

The purified DNA of samples 4,12,14 (29/8/18) were send for sequencing with forward and reverse primer.

05/09/18

Lorenzo

Samples from sequencing were analysed. Custom receptor (12) was placed in the pSB1K3 backbone correctly. The sequence of Cu-promoter::RFP was difficult to interpret. Therefore Cu-promoter::RFP (4) was incubated again in 5 ml LB + Kanamycin from the safe overnight.

06/09/18

Jolijn

The Cu::RFP DNA was purified according to the miniprep protocol with 5 ml bacteria instead of 1.5 ml and eluted in 20 µl elution buffer. DNA was sent for sequencing.

Cu + RFP (4) Code:	Primer
1BA9ZAB414	VF
1BA9ZAB413	VR

10/09/18

Lorenzo

The sequence of Cu::RFP did not contain the copper promotor, only RFP.

11/09/18

Lorenzo

The RFP DNA was cloned into the Copper-promoter vector by cutting the copper-promoter vector with SpeI and PstI, and the RFP vector with XbaI and PstI overnight at 37 °C.

12/09/18

Felix

The prior cut samples were ligated. 2.4 µl RFP DNA was used as insert with 1 µl of Cu promotor backbone. After heat inactivation the sample was transformed according to the iGEM protocol in DH5α and plated on Ampicillin plates.

13/09/18

Lorenzo

Transformation was successful. However, close examination of the samples under the fluorescence binoculars revealed that none of the colonies expressed RFP.

2 colonies were picked and inoculated in 5 ml LB + ampicillin.

22/09/18

Lorenzo

Since our previous attempts didn’t yield any results we decided to place the copper promoter gBlock with the restriction enzymes EcoRI and SpeI. Simultaneously, the RFP vector (PSB1C3) was cut with EcoRI and XbaI. Both reactions were done overnight in NEB Buffer 2.1.

23/09/18

Lorenzo

The digestion product from 09/22/18 was ligated according to the iGEM ligation protocol. 2 µl of ligation product was transformed to E. coli DH5α.

24/09/18

Lorenzo

The reaction mix was inactivated by heating it to 80°C for 20 minutes. A ligation was set up with the fragments, and 9 µl of the ligation product was transformed to 100 µl of competent DH5α.

25/09/18

Felix

The transformation was successful. 6 colonies could be spotted. These were inoculated overnight in 5 ml LB with chloramphenicol.

26/09/18

Lorenzo, Felix

The DNA of the inoculated cultures was minipreped according to the miniprep protocol. After the first spin down we noticed that the bacterial pellet of one of the colonie number 6 was slightly red. Because it is known that RFP expressing bacteria turn red even without excitation, we concluded that it was most likely that this colony expressed RFP, and thus that the transformation worked. After the isolation of the DNA, a colony PCR was done with the VF and VR primer. The total size of the band that we expected was 824 + 156 -6 = 974 bp for the fragment + 271 bp for the part outside the BB_sites generated by the VF and VR primer. The total size of the fragment should thus be 1245 bp. The fragment in lane 6 lies between the 1000 bp band and the 1500 bp band and starts slightly lower than the middle, indicating that it is most likely a band of correct size.

The DNA of this colony was send for sequencing.

29/09/18

Lorenzo

The sequencing results showed that the construct was correct. Since both the promoter::RFP fusion, and the Custom receptor were now available to us on plasmid backbones with different resistance genes, both constructs were transformed to E. coli DH5α.

30/09/18

Lorenzo, Felix

The transformation was successful. A stock solution of 50 mM CuSO₄ was made for experiments with the newly transformed copper sensitive bacteria. 2 colonies were inoculated overnight for further experiments.

01/10/18

Lorenzo

100 µl of the overnight cultures from 30/09/18 was transferred to two tubes containing 5 ml of clean LB. One tube contained 500 µM CuSO₄. Both tubes were inoculated for 45 minutes at 37°C. 400 µl of this culture was washed in 1 ml of PBS and RFP expression was measured with an emission scan between 570 and 640 nm in a Carry Eclipse Fluorescence Photospectrometer using 400 µl of the copper bacterium containing PBS solution. The excitation wavelength used was 555 nm. No fluorescence could be measured, which was probably due to the low amount of bacteria.

02/10/18

Jolijn

A new overnight inoculation of the double transformed bacteria was made.

03/10/18

Felix, Lorenzo

The experiment of 10/01/18 was repeated, but this time CuSO₄ was added to the inoculation at a final concentration of 500 µM, 250 µM, 50 µM, and 5 µM, or 0 µM. The Bacteria were inoculated for 2 hrs at 37°C.

12/10/18

Felix

The following bacteria (DH5α) were inoculated in 5 ml minimal medium, and 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

13/10/18

Jolijn, Felix, Lorenzo

Bacteria in minimal medium did not grow. Cu-promoter::RFP // Custom receptor samples were red coloured while bacteria not containing the custom receptor were yellowish. Fluorescence images were taken to confirm RFP expression. The bacteria containing the Cu-promoter::RFP // Custom receptor were washed 1x in M9 and incubated again overnight in M9 containing 0.4% glucose.

In order to confirm aspartic acid induced RFP expression the experiment was repeated. The following bacteria (DH5α) were inoculated in 5 ml M9 + 0.4% glucose, and in 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

Cu-promoter :: RFP Normarski

Cu-promoter :: RFP Nomarski Fluorescence

Cu-promoter :: RFP // Custom receptor

Cu-promoter::RFP // Custom receptor fluorescence (falsely coloured)

14/10/18

Felix, Jolijn

Bacteria in M9 did not grow. Bacteria in LB did grow but did not express GFP observed with the naked eye. 4 ml bacteria of each of the two samples was washed with 1x with M9 and incubated with M9 + 0.4% glucose.

After 4 hours of incubation in M9 + 0.4% glucose the samples were split up in the following fractions. After 4 hours 500 μl was used for fluorescence measurements using the prior described fluorescence photospectrometer (ex. 585 nm). After 7 hours the remaining 500 μl was used for measurements.

Sample		Asp (10 μ 50 mM)	Cu (2 μl 25 mM)
Custom Receptor	1	+	-
Custom Receptor	2	-	-
Cu-promoter :: RFP	3	+	-
Cu-Promoter :: RFP	4	-	+
Cu-Promoter :: RFP	5	-	-

Sample 1 is not representative at 8 hours since the remaining volume of bacteria was less than the volume in the cuvette. Therefore this sample was diluted which resulted in a increased intensity as the cuvette was now fully filled, however, the measurement did not reach its full potential.

The Cu-promoter::RFP // Custom receptor sample washed (13/10/18) and incubated overnight was split up in two 4 ml fractions. To one fraction 40 μl 50 mM Aspartic acid was added and incubated for 4 hours. After 4 hours 500 μl was used for fluorescence measurements, this was repeated at 8 and 11 hours

Although these data are not conclusive it indicates that the custom receptor has a reaction on the addition of aspartate. Therefore new samples were inoculated in 5 ml LB.

Custom // Cu-promoter :: RFP	3x
Custom // Cu-promoter :: RFP Asp+ 500 μM	1x
Cu-promoter :: RFP	3x
Cu-promoter :: RFP Asp+ 500 μM	1x
Cu-promoter :: RFP 50 μM CuSO4	1x

30/07/18

Lorenzo, Floor

Isolated biobricks (listed in table below) and transformed them to E. coli Dh5ɑ according to the transformation protocol.

Biobrick	Kit location*	Part name	Part size (bp)
BBa_K608003	1/5A	Promoter +RBS	56
BBa_K569017	1/8K	CheY	390
BBa_K629003	1/18G	CheZ	644
BBa_I759001	3/3J	Rluc	936
BBa_B0017	3/6C	Terminator	128 **
BBa_I15017	4/21N	eYFP	717

* location name is as follows: plate number/well number (e.g. 1/5A means plate 1 well 5A)
** this part contains two copies of BBa_B0010 (64 bp each) but the exact size of the fragment is unspecified on the wiki page.

31/07/18

Lorenzo, Floor

Transformation was successful, colonies were picked and inoculated in 5 ml LB containing the correct antibiotic.

01/08/18

Lorenzo, Floor

Isolated the plasmids containing the biobricks from the inoculated colonies from 31/07/18 according to the plasmid purification protocol. (for concentrations see table below)

			Concentration (ug/ml)
Biobrick	Kit location*	Part name	Replicate 1	Replicate 2
BBa_K608003	1/5A	Promoter +RBS	76,8	77,8
BBa_K569017	1/8K	CheY	51	50,5
BBa_K629003	1/18G	CheZ	83,1	111,9
BBa_I759001	3/3J	Rluc	81,2	89,7
BBa_B0017	3/6C	Terminator	137,8	75,4
BBa_I15017	4/21N	eYFP	70	70,9

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, CheZ, Rluc, eYFP so that they can be used for Gibson assembly later in the project. The primers used are listed in the table below.

Part	Primer name	Primer sequence 5’--> 3’
CheZ	CheZ_F1	gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
	CheZ_R1	CCTTGGAAGCCATTCCACCTCCACCTCCAAATCCAAGACTATCCAACAAATCG
Rluc	Rluc_F1	AGTCTTGGATTTGGAGGTGGAGGTGGAATGGCTTCCAAGGTGTACG
	Rluc_R1	tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag
eYFP	YFP_F1	gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
	YFP_R1	CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG
CheY	CheY_F1	CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG
	CheY_R1	tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

02/08/18

Lorenzo

Performed a gel electrophoresis on the PCR product from 01/08/18 on a 1.5% agarose gel according to the gel electrophoresis protocol. The resulting bands were isolated according to the gel purification protocol.

PCR product	Concentration (ug/ml)
CheY	/
Rluc	45,6
CheZ	59,9
eYFP	26,6

A second PCR was performed to retrieve CheY. Also eYFP, LuxA, and LuxB were amplified with overhang extension PCR to add a gibson overhang to these parts. Used primers are listed in the table below.

Part	Primer name	Sequence 5’ -> 3’
LuxA	M13 fwd	tgtaaaacgacggccagt
	LuxAB_Gibson_R1	gatttGGAGGTGGAGGTGGAATGAAGTTTGGAAACTTCCTG
LuxB	LuxAB_Gibson_F1	gatttGGAGGTGGAGGTGGAATGAAGTTTGGAAACTTCCTG
	T3	tccctttagtgagggttaat
eYFP	YFP_F1	gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
	YFP_R1	CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG
CheY	CheY_F1	CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG
	CheY_R1	tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

The PCR product was ran on a 1.5% agarose gel (figure 2)

03/08/18

Lorenzo

LUXA and LuxB were isolated using PCR directly from the gBlock, since we expected the product of 02/08/18 to contain an error. The PCR product was ran on a 0.8% agarose gel and the correct bands were isolated according to the gel extraction protocol.

06/08/18

Floor

The CheZ and RLuc, and LuxA and LuxB fragments were fused together using Gibson assembly as described in the Gibson protocol. 9 µl of each Gibson product was transformed to 100 µl of DH5ɑ, since this increases the amount of successful transformations.

07/08/18

Floor

The transformations were successful. 2 colonies from each plate were picked and analysed for bands of a correct size through colony PCR as described in the colony PCR protocol. These bacteria were inoculated overnight at 37 °C in a rotary shaker.

08/08/18

Lorenzo

DNA of inoculations (07/08/18) was purified in accordance with the miniprep protocol. The acquired DNA was sent for sequencing.

09/08/18

Lorenzo

PCR was performed according to the protocol to create the correct overhangs for gibson assembly of CheY.

10/08/18

Jolijn, Felix

PCR product from 09/08/18 was ran on 0.8% gel and isolated the DNA using the Gel purification protocol

15/08/18

Floor, Lorenzo

eYFP::CheY was assembled according to the Gibson cloning protocol. The cloning product was transformed into DH5α according to the iGEM transformation protocol.

16/08/18

Lorenzo

Made a plate containing the positive colonies and inoculated them overnight.

Colony PCR of ((18/08/18 eYFP::CheY)(08/07/18 CheZ::Rluc)) was performed according to the protocol. Positive samples were selected and inoculated overnight.

17/08/18

Felix eYFP::CheY DNA 16/08/18

Inoculation from colony	Concentration (ng/µl)
1	224.5
2	277.5
3	334.4
4	280.4

20/08/18

Felix

The purified DNA samples (17/08/18) were sent for sequencing with m13 forward and reverse primer.

27/08/18

Lorenzo, Floor

Performed a PCR of CheY, Lux AB, CheZ and eYFP with the following primers:

DNA	Forward Primer	Reverse Primer
1. CheY (kit)	Long Forward	CheY reverse
2. CheY (kit)	Short forward	CheY reverse
3. CheY (Gblock)	GblockCheY forward	Reverse 2
4. LuxAB	LuxAB forward, CheZ overhang	M13 reverse
5. CheZ (kit)	CheZ forward 1	CheZ reverse, luxAB overhang
6. eYFP	eYFP forward	eYFP reverse

The samples were ran on an 0.8% gel and bands were isolated

1	2	3	4	5	6
10	10.1	5.7	3.7	0.9	0

28/08/18

Floor

Repeat of 27/08/18, difference: PCR settings as KOD polymerase with 35 cycles. Ran the product on 0.8% (w/v) agarose gel and isolated it using the gel purification protocol.

The fragments were used to perform a Gibson assembly of eYFP::CheY, and 9 µl of the product was transformed to 100 µl DH5α.

29/08/18

Floor

We checked the plates from 28/08/18 but none of the transformations were successful.

03/09/18

Lorenzo

We performed the gibson reaction of eYFP::CheY again. The gibson product was transformed directly to DH5α. Furthermore, a Gibson overhang for the CheZ and LuxAB fragments was created by PCR with primers that were extended. The PCR products were ran on a 0.8% agarose gel. The gel revealed faint bands, but no ladder. Hence we didn’t proceed with these samples.

11/09/18

Lorenzo

Since our constructs used during our project needed a promoter in order to be expressed promoter BBa_K608003 was isolated from the DNA distribution kit (plate 1 well 5A). This DNA was transformed to DH5α.

12/09/18

Felix

Colonies from 11/09/18 were picked and inoculated overnight.

13/09/18

Lorenzo

DNA from inoculations was isolated according to the miniprep protocol. The promoter part was was cloned in front of Both eYFP::CheY from 28/08/18, and CheZ::RLuc using the iGEM 3A assembly protocol. The samples were transformed to DH5α.

14/09/18

Lorenzo

eYFP::CheY plates were observed under the fluorescence binoculars. 2 YFP colonies could be observed. These colonies were inoculated overnight at 37°C.

15/09/18

Felix

The inoculated bacteria were used for a miniprep and the DNA was send for sequencing.

06/10/18

Felix Oligo annealing

Oligos containing the promoter CheZ::RLuc part sequence were annealed according to the annealing protocol

CheZ Rluc Digestion

Two CheZ::Rluc samples (CheZ::Rluc 440 ng/μl, CheZ::Rluc 430 ng/μl) were digested with Xbal and EcoR1 according to the iGEM restriction digest protocol.

Oligo CheZ::Rluc ligation

Protomoter Oligo was ligated into the Xbal Rluc digested CheZ::Rluc backbone according to the iGEM T4 ligase protocol . 1 μl of CheZ::Rluc backbone with 1 μl of oligo was used. Both 440 ng/μl and 430 ng/μl sample were ligated with the oligo.

Transformation

The new vector product (promoter::CheZ::Rluc) was transformed into DH5α according to the iGEM transformation protocol.

• CheZ Rluc A
• CheZ Rlux B

Anneal A = Oligo insert::CheZ::Rluc (originating from sample CheZ::Rluc 430 ng/μl )
Anneal B = Oligo insert::Chez::Rluc (originating from sample CheZ::Rluc 440 ng/μl )

07/10/18

Felix

Transformation was succesful

Three colonies were picked from transformation A and two colonies were picked from transformation B, both were inoculated in 5 ml LB containing ampicillin.

08/10/18

Lorenzo

DNA was purified from the following samples using the miniprep protocol and sent for sequencing.

Sample	Concentration ng/μl
CheZ Rluc A4	584.1
CheZ Rluc B4	549.6
CheZ Rluc A2	522.3
CheZ Rluc A1	463.8
CheZ Rluc B3	539.9

The Gibson cloning was transformed in DH5α according to the protocol.

09/10/18

Lorenzo

Transformation was successful

Two colonies were picked and inoculated in 5 ml LB containing ampicillin.

10/10/18

Lorenzo, Felix

DNA from the two inoculation of 1/5A::CheZ::Rluc after Gibson cloning was retrieved with miniprep according to the protocol in the following concentrations.

Sample 1: 139.9 ng/μl
Sample 2: 75.5 ng/μl

11/10/18

Felix, Jolijn, Mike

In order to implement the complete BRET-pair and the mutated TAR-receptor, all three constructs needed to be in different vectors. Therefore, the CheZ Rluc and 1/5A::eYFP::Chey DNA was put in the iGEM pSB1K3 vector. Both samples including the vector were cut with EcoRI and PstI. Assembly of products was performed according to the iGEM 3A assembly protocol resulting in the following samples:

1/5A eYFP CheY in pSB1K3
1/5A CheZ Rluc in pSB1K3 (sample 1)
1/5A CheZ Rluc in pSB1K3 (sample 2)

These samples were transformed in combination with the mutated TAR receptor DNA. The following samples were transformed.

Sample	Content	Cell line
1	SDM Q491A	DH5α
2	SDM E309A	DH5α
3	[⅕A::eYFP::CheY] Kan	U1250
	[SDM Q491A] Chlo
	[CheZ::Rluc] Amp
4	[CheZ::Rluc (sample 1)] Kan	U1250
	[SDM Q491A] Chlo
	[⅕A::eYFP::CheY] Amp
5	[CheZ::Rluc (sample 2)] Kan	U1250
	[SDM Q491A] Chlo
	[⅕::eYFP::CheY] Amp
6	[[⅕A::eYFP::CheY] Kan	U1250
	[SDM E309A] Chlo
	[CheZ::Rluc] Amp
7	[CheZ::Rluc (sample 1)] Kan	U1250
	[SDM E309A] Chlo
	[⅕A+eYFP+CheY] Amp
8	[CheZ::Rluc (sample 2)] Kan	U1250
	[SDM E309A] Chlo
	[⅕A::eYFP::CheY] Amp
9	[⅕A::eYFP::CheY] Kan	DH5α
10	[CheZ::Rluc (sample 1)] Kan	DH5α
11	[CheZ::Rluc (sample 2)] Kan	DH5α

12/10/18

Felix, Lorenzo

SDM transformations (Lab Journal lab journal Methylation ) and triple transformations were successful. When the plates were inspected under the fluorescence binoculars, several eYFP positive colonies could be identified that weren’t RFP positive. This indicated that these bacteria contained all 3 plasmids, and weren’t antibiotic resistant due to self ligation events of the linearized vector backbone used on 11/10/18.

2 colonies were picked and inoculated in 5 ml LB with ampicillin, kanamycin, chloramphenicol. The selection of colonies was based on increased YFP expression and low RFP expression (background plasmid signal).

The following samples were transformed

U1250

Sample	Cell line
6/15B (TAR WT),	U1250
FRET pair	U1250
BRET pair (1/5A::CheZ::Rluc)(1/5A::eYFP::CheY)	U1250
6/15B (TAR WT), FRET pair	U1250
6/15B (TAR WT), BRET pair (1/5A::CheZ::Rluc)(1/5A::eYFP::CheY)
FRET pair, SDM E309A	U1250
FRET pair, Q491A	U1250

13/10/18

Felix, Jolijn

Inoculations were spun down, washed once with 1x PBS and resuspended in 1x PBS. 500 μg coerentazine was solubilized in ethanol to reach a final concentration of 7.5 mM. An aliquot was taken from this stock to make a 30x solution with 1x PBS. 480 μl bacteria were put in a 400 μl quartz cuvette and 20 μl 30x coerentazine solution was added. The solution was oxygenated using a pipette. No luminescence could be observed, indicating that the coelenterazine is not oxidized by luciferase. Fluorescence measurements of a wavelength that excites YFP, proved YFP to be present.

Jolijn

17/10/18

Samples that were transformed on 12/10/18, consisting of both the BRET pair and the tar receptors with altered amino acid sequence (to mimic methylation) were inoculated in LB.

Jolijn

17/10/18

The inoculated samples were transferred to a citrate phosphate buffer (0.15 M, pH 5). Coelenterazine was added to a final concentration of 7.5 µM. Measurements were performed, there was no measurable luminescence.

30/07/18

Jolijn

Transformation of Tar part 1

The Tar, Tar GFP and Tar GFP His plasmids received on a filter paper from team Technion Israël 2016 were dissolved in 80 µL elution buffer. ~40 µL of plasmid dissolved in elution buffer was extracted. Competent DH5α cells were then transformed with the dissolved plasmids according to the iGEM protocol. Since the type of antibiotic resistance was unknown, Kanamycin, Ampicillin and Chloramphenicol were used as antibiotics.

31/07/18

Jolijn

Transformation of Tar part 2

The transformation of Tar GFP His on chloramphenicol was the only successful transformation. Two colonies were picked and inoculated in 5 ml LB containing chloramphenicol.

01/08/18

Jolijn

Transformation of Tar GFP His part 3

Tar GFP His DNA was isolated from the inoculation (31/07/18) according to the MiniPrep protocol. An aliquot of the left bacteria was plated in fresh agar plates.

Transformation of Tar part 1

The DNA concentration of the Tar, Tar GFP and Tar GFP His samples were measured, concentrations are listed in the table below.

Sample	Concentration
Tar	10.4 µg/mL
Tar GFP	9.1 µg/mL
Tar GFP His	11.1 µg/mL

The desired concentration of DNA for transformation is 100 ng in a 50 µL solution. Due to the low concentration of our samples, 5 µL of DNA sample was added to the 50 µL DH5α competent cells. Additionally, the Tar receptor (6/4j) and Tar receptor with promotor (6/15B) plasmids from the distribution kit were transformed as described in the iGEM transformation protocol.

02/08/18

Felix, Jolijn

Transformation of Tar part 2

All transformations were successful, with a high colony density. One colony per sample was inoculated for 6 hours. After 6 hours the colonies were put in 5 ml LB + chloramphenicol and incubated overnight 37°C 200 rpm. Samples were as described below.

Tar A	Ta
Tar B	Tb
Tar Kit A	Tka
Tar Kit B	Tkb
Tar GFP A	Tga
Tar GFP B	Tgb
Tar GFP His A (Israel)	Tgha
Tar GFP His B (Israel)	Tghb
Promotor Tar Kit A	Ptka
Promotor Tar Kit B	Ptkb

03/08/18

Felix, Jolijn

Transformation of Tar part 2

DNA was retrieved from the following samples using miniprep according to protocol.

Receptor	ug/ml
T B	65.8
T A	66.5
Tk A	60.7
Tk B	75.4
Tg A	73.3
Tg B	69.1
Tgh B	61.6
TghA	77.7
Ptk A	68.6
Ptk B	78.9

Site Directed Mutagenesis (SDM) was performed to mimic constant methylation of the Tar receptors. The experiment was carried out according to the SDM protocol. Only B samples from the duplo were used for SDM. Following primers were used to specifically mutate Q491A and E309A.

E491A_F	GCATCGCTGGTGCAGGCGTCAGCTGCCGCCGCC
E491A_R	GGCGGCGGCAGCTGACGCCTGCACCAGCGATGC
Q309A_F	CTGCCGCCAGCATGGAGGCGCTCACCGCGACAGTGAAG
Q309A_R	CTTCACTGTCGCGGTGAGCGCCTCCATGCTGGCGGCAG

06/08/18

Jolijn

The prior made (03/08/18) SDM plasmids were transformed in duplo into DH5α cells according to the iGEM protocol.

07/08/18

Felix

Transformation was successful. The colony density was very high, which made it difficult to pick specific colonies for further incubation. Yet, colonies were picked and activated in 1 ml LB + chloramphenicol for 5 hours. After 5 hours no bacterial growth was observed. Colonies were picked again and inoculated overnight in 5 ml LB + chloramphenicol. To ease colony picking, a colony of each sample was picked roughly and spread and diluted on a new agar plate + chloramphenicol. This plate was incubated overnight at 37°C.

08/08/18

Jolijn, Felix

The colonies picked on 07/08/18 were diluted successfully. The plasmid DNA of the inoculations (07/08/18) was purified according the miniprep protocol.

Following concentrations were observed.

Receptor	Concentration ug/ml
Tb2	43.6
Tb1	49.1
Tgb2	52.7
Tgb1	28.1
Tkb2	46.33
Tkb1	46.3
Tgh2	15.3
Tgh1	50.8
Ptkb2	3
Ptkb1	32.6

Tb2 and Tgb2 were sent for sequencing, although DNA concentration was not optimal. DNA concentrations were not satisfactory, new colonies were picked and inoculated in 5 ml LB with chloramphenicol. A control was included to compare retrieved DNA concentrations.

09/08/18

Jolijn, Felix

DNA from inoculations was retrieved using miniprep according to the protocol. One modification was applied, the elution buffer was heated (60°C) before use and only 30 µl was applied on the spin column.

Receptor	Concentration (µl/ml)
T1	102.9
T2	106.2
Tg1	85
Tg2	110.2
Tk1	33.9
Tk2	68.8
Ptk1	13.3
Ptk2	71
Tgh1	48.2
Tgh2	49.1
Control (Vector = PbsK)	428.4

13/08/18

Felix

TG, TG2, T1,T2 were sent for sequencing.

14/08/18

Jolijn

Sequencing data revealed presence of GFP in all the sent sequences.

27/08/18

Jolijn

Colony picking of E. coli

E. coli used for the interlab study were picked and inoculated for an hour.

Genomic PCR

The obtained samples were used for colony PCR. Afterwards, the samples were loaded on a 0.8% agarose gel at 120 V for 20 minutes. Bands were isolated and purified, using the gel purification protocol. The concentrations were too low to continue (1.3µL and 1.9µL).

29/08/18

Jolijn

Receptor assay inoculations (custom receptor//Cu-Promoter::RFP sample 13 and 14 were used for genomic PCR. 1 mL of these cell cultures were used and spun down on 12000 x g for 1 minute. The supernatant was removed and resuspended in 100 µL milli-Q, after which custom 13 was heated at 85 °C’. The samples were diluted 0, 10 and 100 times and the resulting dilutions were used for 1-Taq PCR using the KOD polymerase protocol.

Next, 50 µL loading buffer was added and all samples from custom 13 and 14 were loaded in lane 2 and lane 3 of a 0.8% agarose gel respectively. The bands were isolated and put together. The DNA concentration was 146.1 µg/mL.

30/08/18

Jolijn

T4 PNK Phosphorylation and T4 ligation

The DNA fragments were phosphorylated according to the T4 PNK Phosphorylation protocol Using the following pipet scheme:

Compound	Volume
DNA	15 µL
10x buffer	2 µL
ATP 10 mM	2 µL
T4 PNK	1 µL

Next, ligation was done in order to ligate the isolated Tar receptor DNA into the pBSK vector. This was done according to the following pipetting scheme:

Compound	Volume
T4 ligase	0.9 µL
Buffer	1 µL
Vector	1 µL
DNA	7.60 µL

After four hours of incubation, competent DH5α cells were transformed with the sample in duplo according to the iGEM transformation protocol.

11/09/18

Jolijn, Lorenzo

Transformation was successful, colonies were picked. Cells were incubated in 4 mL LB with 4 µL ampicillin.

30/09/18

Lorenzo

Tar receptor received from Groningen and transformed into DH5a according to the protocol.

03/10/18

Lorenzo

Tar receptor DNA was isolated using miniprep, DNA concentration was 356.3 ng/ul. First site directed mutagenesis was performed (E491A) using phusion polymerase and listed HPLC purified primers.

E491A_F	GCATCGCTGGTGCAGGCGTCAGCTGCCGCCGCC
E491A_R	GGCGGCGGCAGCTGACGCCTGCACCAGCGATGC
Q309A_F	CTGCCGCCAGCATGGAGGCGCTCACCGCGACAGTGAAG
Q309A_R	CTTCACTGTCGCGGTGAGCGCCTCCATGCTGGCGGCAG

04/10/18

SDM1 (E491A) was digested with DpnI for 1.5 hours and heat inactivated for 30 min. SDM2 (Q309A) was performed with SDM1 (E491A) as template. As the DNA concentration could not be retrieved, a titer of three different DNA concentrations was in three different DNA volumes:

• 0.3 ul
• 0.7 ul
• 1.1 ul

SDM1 (E491A) and SDM 2 (Q309A) were transformed in DH5a. During transformation, heat shock was performed inaccurately, therefore, the transformation was performed again.

1.1 (E491A) → SDM 1
2.1 (Q309A) → SDM A 0,3 ul
2,1 (Q309A) → SDM B 0,7 ul
2,1 (Q309A) → SDM C 1,1 ul

Second Transformation:

1.1 (E491A) → SDM 1 second time
2.1 (Q309A) → SDM 2.1 A second time 0.3 ul
2.1 (Q309A) → SDM 2.1 B second time 0,7 ul
2.1 (Q309A) → SDM 2.1 C second time 1.1 ul

05/10/18

Felix Several transformations were successful.
Two colonies from the following transformations were inoculated
1.1 (E491A) first time
1.1 (E491A) second time
2.1 (Q309A) B 0,7 ul

05/10/18

Felix, Lorenzo

DNA from the following samples was purified according to the miniprep protocol.

DNA 6/15B (Groningen) (DNA 6/15B → SDM 1.3 (E491A))
SDM (E491A) 1.2 A (SDM 1.2 A → SDM 2.2 (Q309A) A)
SDM (E491A) 1.2 B (SDM 1.2 B → SDM 2.2 (Q309A) B)

Following samples were transformed.

Chloramphenicol + Ampicillin, U1250

• pVS88 + Tar SDM 1.2 (E491A) A
• pVS88 + Tar SDM 2.1 (Q309A) A
• pVS88 + Tar SDM 2.2 (Q309A) A
• pVS88 + Tar SDM 2.2 (Q309A) B

Chloramphenicol DH5α

• Tar SDM 2.2 A (Q309A) (Not digested with DpnI overnight)
• Tar SDM 2.2 B (Q309A) (Not digested with DpnI overnight)
• Tar SDM 2.1 A (Q309A)
• Tar SDM 2.1 B (Q309A)
• Tar SDM 2.1 C (Q309A)
• Tar SDM 1.3 (E491A)

07/10/18

Jolijn

Following sequences were transformed according to the iGEM protocol to DH5α

• SDM 2.1 (Q309A) C
• SDM 2.2 (Q309A) A after overnight DpnI
• SDM 2.2 (Q309A) B after overnight DpnI

Transformations were succesfull

Following sequences were inoculated

• CheZ Rluc A (1)
• CheZ Rluc B (1)
• CheZ Rluc A (2)
• CheZ Rluc A (3)
• CheZ Rluc B (2)
• SDM 2.1 (Q309A) B
• SDM 1.3 (E491A) (1)
• SDM 1.3 (E491A) (2)

08/10/18

Felix

DNA was acquired from samples according to the miniprep protocol with the following DNA concentrations.

Sample	Concentration (ng/μl)
SDM 2.1 (Q309A) B	171.1
SDM 1.3 (E491A) (1)	212.2
SDM 1.3 (E491A) (2)	110.3

Inoculation

Transformations: SDM 2.2 (Q309A) A after overnight DpnI, SDM 2.2 (Q309A) B after overnight DpnI, SDM 2.1 (Q309A) C (1.1 μl), were successful.

Two colonies were picked from the following samples:

SDM 2.2 (Q309A) A after overnight DpnI

SDM 2.2 (Q309A) B after overnight DpnI

One colony was picked from

• SDM 2.1 (Q309A) C (1.1 μl)

09/10/18

Felix

DNA from the following inoculations was purified

• 2x SDM 2.2 (Q309A) A after overnight DpnI
• 2x SDM 2.2 (Q309A) B after overnight DpnI
• 1x SDM 2.1 (Q309A) C (1.1 μl)

The following concentrations were measured and sent for sequencing.

Sample	Concentration (ng/μ)	Sent for Seq.
SDM 2.1 (Q309A)  C	253.2	VF: 1BA9ZAB682
		VR: 1BA9ZAB681
SDM 2.2 (Q309A) A	188
SDM 2.2 (Q309A) A2	309	VF: 1BA9ZAB678
		VR: 1BA9ZAB677
SDM 2.2 (Q309A) B	219.7	VF: 1BA9ZAB680
		VR: 1BA9ZAB679
SDM 2.2 (Q309A) B2	173.7

10/10/18

Felix

Analysis of the sequences revealed that none of the samples contained the desired DNA sequence with the specific mutation.

11/10/18

Felix, Lorenzo

Again SDM was performed (SDM Q491A as well as SDM E309A) according to the protocol using phusion polymerase with lower primer concentrations of vector DNA. SDM Q491A as well as SDM E309A were transformed in DH5α according to the protocol. The two SDM samples were also transformed in U1250 with the BRET pair (lab journal BRET ).

11/10/18

Felix

SDM transformations were successful. 2 colonies from each SDM sample were picked and inoculated in 5 ml LB with chloramphenicol. SDM transformation in combination with the BRET pair were successful as well (lab journal BRET).

E309A Q491A