Line 37: | Line 37: | ||
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on <a target="_blank" style="color:blue" href="http://parts.igem.org/">parts.igem.org</a>.</h4> | This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on <a target="_blank" style="color:blue" href="http://parts.igem.org/">parts.igem.org</a>.</h4> | ||
<ul> | <ul> | ||
− | <li><b>Composite parts:</b></b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part: | + | <li><b>Composite parts:</b></b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671420">BBa_K2671420</a> </li> |
− | <li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part: | + | <li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671337">BBa_K2671337</a> </li> |
<li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | <li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | ||
<li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602011">BBa_K2602011</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602014">BBa_K2602014</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602016">BBa_K2602016</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602021">BBa_K2602021</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602024">BBa_K2602024</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602026">BBa_K2602026</a></li> | <li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602011">BBa_K2602011</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602014">BBa_K2602014</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602016">BBa_K2602016</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602021">BBa_K2602021</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602024">BBa_K2602024</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602026">BBa_K2602026</a></li> |
Revision as of 12:10, 12 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602011, BBa_K2602014, BBa_K2602016, BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga