Labwork and Results

There are a few different parts that constitutes this project, to give you a quick overview: CRISPR- cas9 the yeast in order to allow it to produce alpha-pheromone Myrosinase as a cancer toxin p28 as a cancer toxin

The goal of the CRISPR-Cas9 system was to delete BAR1, which is a part of the mating system of yeast and leads to the degradation of alpha-pheromone inside of the yeast, and replace it with mf-alpha, the protein which codes for the alpha pheromone. This construct was transformed into yeast and the resulting strain was used for all further transformations related to the cancer toxins. The reason for this is that the cancer toxins were put under a FUS1 promoter which is only responsive to the alpha pheromone.

Moving into this project both Myrosinase and p28 were planned to be utilized at the same time in the same yeast. However during the beginning of august it was decided that p28 should be dropped and that myrosinase would be the sole focus. This was due to poor modeling results for the p28 and a strict time limit to this project.

This means that the construct containing p28 was never transformed into yeast and thus never tested in vitro. The Myrosinase however was transformed into our edited yeast strain and its efficiency was tested on RKO cells in vitro.

There was a few different plasmid used for these constructs. The CRISPR-cas9 plasmid used was a KanMX Cas9 Plasmid. It has a kanamycin resistance for the e.coli and a g418 resistance for the yeast selection process. BOIIIIIIIII ASKE ALEXE. The remaining constructs were put into the p413TEF plasmid which contains the gene HIS3 as its marker. The p413TEF plasmids were however edited and the TEF promoter was switched out for the FUS1 promoter. This was done since we wanted the yeast to express the proteins of interest only in the presence of pheromones.

kanMX-cas9 and gRNA

The plasmid kanMX-cas9 was used as the source for the CRISPR system that was utilized in order to edit the genome of a 11C S. cerevisiae strain. The gRNA sequence (GCTGACGGAACATTTGCTGA) was developed via a tool built into benchling. The sequence was put into a kanMX-cas9 plasmid to be transformed into yeast, see figure XX.

Since we wanted to delete BAR1 and introduce mfalpha2 into the genome a repair fragment was constructed. The mfalpha was put under the FUS1 promoter as we want a positive feedback loop for the production of alphapheromone, see figure XX.

Checking the deletion of BAR1 and insertion of mf-alpha

In order to evaluate if the deletion and insertion was successful a genomic PCR was carried out. Using primers which are placed up/downstream of the BAR1 site. Since the size difference between the BAR1 and the FUS1 promoter plus the mf-alpha gene is about 700bp, 2.3kb for BAR1 and 1.6 kb for FUS1+mf-alpha, the differenc between the two should be asy to spot on a regular gel.

Unfortunately the deletion seems to not have worked. The PCR was run on several different colonies from the plates that selected for the cas9 plasmid. The PCR was also ran with several different temperatures and polymerases. There were however always no bands or bands at the 2.3 kb mark. So it was assumed that the gRNA or the gibson had not worked as intended, considering that the plasmid obviously had been transformed into the yeast as it was able to grow on g418 agar plates.

pFUS1-GFP

Even thought the incoroporation of mfalpha2 into the genome of our yeast strain seemed to have failed we still wanted to check how expression levels were related to the prescence of alpha pheromone. They way we went about this was by making a construct with GFP regulated by the FUS1 promotor. The idea was that an assay with different concentrations of alpha pheromone could be used to improve our modelling with our own results from the lab.
fw_GFP(pFUS1) and rv_GFP(pFUS1), rv_pFUS1(GFP) and fw_pFUS1(Myr1)(works for all pFUS1 constructs not just Myrosinase ones)

Protein	Full name	Native organism	Sequence source
pFUS1	FUS1 promoter	Optimized for Saccharomyces cerevisiae	iGEM parts registry: BBa_K1072023
GFP	Green Fluorescent Protein	Optimized for Saccharomyces cerevisiae	SysBio lab at Chalmers

Testing the construct

The constructs were tested in a very simple manner. A overnight culture of the yeast was prepared in delft+HIS media and left to grow at 30 degrees. The next day the culture was split into 16 different pcr tubes each containing 100 microlitres of culture. Alpha-pheromone, final concentration of 20 micromolar was added to half of the tubes and they were incubated in 30 degrees for an additional two hours.

However it turned out that both the negative and positive cultures all had yeast expressing GFP. The conclusion that was drawn was that the gibson had failed and that the TEF promoter was somehow still present. As the results for the genomic PCR for verification of the CRISPR insert did not yield any results this seemed to be the only explanation.

p413-FUS1-Alphapro-Myrosinase

The p413TEF plasmid was cut with with the enzymes Sac1 and Xho1 to get rid of the TEF-promoter and in order to allow the protein of interest to expressed exclusively in the presence of alpha-pheromone.

Protein	Full name	Native organism	Sequence source
Kozak sequence	Kozak sequence	Optimized for Saccharomyces cerevisiae	SysBio lab at Chalmers
Alpha factor	Alpha factor leader	Optimized for Saccharomyces cerevisiae	SysBio lab at Chalmers
Kex2	Kex2	Synthetic sequence	SysBio lab at Chalmers
Spacer	gaagaaggtgaaccaaaa	Synthetic sequence	https://onlinelibrary.wiley.com/doi/full/10.1002/bit.24409
Myr1	Myrosinase	Optimized for Saccharomyces cerevisiae	Uniprot

As the experiments with pFUS-GFP seemed to indicate that the TEF promoter had not been deleted properly we were worried about how our larger constructs would be integrated into the plasmids. But sequencing of this construct later revealed that the pFUS promoter had been efficiently inserted into the plasmid and that the construct was perfectly fine.

Testing the construct

To test the activity and secretion of the myrosinase in the S.cerevisiae the following procedure was performed:

RKO cells were grown in Eagle's Minimum Essential Media + 10% FBS, by one of our supervisor in the university's cancer cell lab. The cells were grown in 24-well plates until 80% confluence. Whilst the cancer cells were growing an 50 ml Delft+HIS media overnight culture of the S.cerevisiae transformed with the myrosinase construct was prepared and incubated at 30 degrees. The next day the culture was pelleted through centrifugation and split into two tubes. The cells were resuspended in 4 ml DELFT+HIS media and 66 microlitres of alpha-pheromone (1mg/ml) to each tube to start production of the myrosinase. The yeast was incubated at 30 degrees for 2 hours and then placed in the fridge for use the next day.

The cultures with added alpha-pheromone were filtered through a 0.45 micrometer sterile cellulose filter, to yield a cell free myrosinase solution. The cell free myrosinase solution was split into two tubes containing 600 microlitres each, to one of the tubes 100mg of sinigrin was added. 100 microlitres of the cell free solutions was mixed into 400 microlitres of fresh media. The solution with sinigrin was added to six wells and the solution without sinigrin was added to another six wells. The cancer cell + myrosinase solution was incubated for 48 hours and after that the wells were examined under a microscope. The results was that all the cells in the wells containing sinigrin had died and there were still a considerable amount of cells in the control wells.