Difference between revisions of "Team:JMU Wuerzburg/Basic Part"
| Line 24: | Line 24: | ||
</div> | </div> | ||
</div> | </div> | ||
| − | |||
</html> | </html> | ||
Latest revision as of 15:48, 17 October 2018
Part BBa_K2614000
We developed a primer/probe set for a qPCR, which detects the human pathogens of the genus Plasmodium. This part can be used as positive control for our qPCR.
If you like to run this qPCR you need one sense primer (CTGGCTAAACTTCCCAATGA), one antisense primer (GTCTATATTCATGTTTGATTGACCTT) and a dual labeled Probe ([6FAM]CTTcCAaATaGAtTTCGCAGAA[BHQ1] (lowercase letter = LNA)).
qPCR with primer/probe set for Plasmodium in general. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
Multiplex qPCR with primer/probe set for Plasmodium in general and Plasmodium falciparum. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
qPCR with primer/probe set for Plasmodium in general. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.
Multiplex qPCR with primer/probe set for Plasmodium in general and Plasmodium falciparum. BBa_K2614000 as positive control, cultured Plasmodium stems and negative control are shown.