Team:Linkoping Sweden/Parts

• Home
• Project
• Human Practice
• Collaborations
• Team
• Attributions

All parts

Collection

This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.

• Composite parts: BBa_K2671337
• Basic Parts: BBa_K2671420
• Improved parts: BBa_K2671000
• Verified collaboration parts: BBa_K2602011, BBa_K2602014, BBa_K2602016, BBa_K2602021, BBa_K2602024, BBa_K2602026
• Verified biobrick: BBa_I746909

Primers used for all our experiments can be found below.

• Vector reverse (VR): attaccgcctttgagtgagc
• Vector forward 2 (VF2): tgccacctgacgtctaagaa
• Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
• Backbone ENX forward (BENXF): tactagtagcggccgctg
• Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
• Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
• Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga