Team:Utrecht/Notebook


Receptor Assay

August
September
October

BRET Assay

July
August
September

Methylation Assay

July
August
September
Mo
Tu
We
Th
Fr
Sa
Su

Morning

Performed Calibration 1, 2, and 3 according to protocol. All measurements were performed using the plate reader of Seino.

Table 1. content 96 wells plate cal.1 and cal.2
123456789101112
ALdd
BLdd
CLdd
DLdd
E MSdddddddddddd dddddddddd
FMSdddddddddddd dddddddddd
G MSdddddddddddddddddddddd
H MSdddddddddddddddddddddd
Calibration 1
  • L= 100 uL Ludox CL-X (stored at 4C)
  • dd= 100 uL ddH20
  • Measurement: Abs600, turn off pathlength correction
Calibration 2
  • MS= 200 ul Microsphere Stock Solution
  • dd= 100 uL ddH20
  • green= serial dilution was performed with a micropipet from E1,F1,G1,H1 - E11,F11,G11,H11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: Abs600, re-mix befor putting in plate reader and prevent bubbles, path length correction off
Calibration 3
  • 1xFC= 200 mL 1xFC (100uL 10x fluorescein + 900ul 1x PBS pH 7.4, tube was covered with foil
  • P= 100 uL 1x PBS pH 7.4
  • green= serial dilution was performed with a micropipet from A1,B1,C1,D1 - A11,B11,C11,D11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: FL, 530nm/30nm bandpass, 25-30nm with recommened excitation of 485nm, emission 520-530nm of the filter. Path length correction was turned off
Table 2. content 96 wells plate cal.3
123456789101112
A1xFCPPPPPPPPPPP
B1xFCPPPPPPPPPPP
C1xFCPPPPPPPPPPP
D1xFCPPPPPPPPPPP
E
F
G
H

Afternoon

LBC plates were made according to the protocol used on the wall
  • 250ml LB 2x added to melted 250 ml WA 2x using a microwave
  • 0.5ml was added to final solution
  • plates were dried in 37C incubator
Transformation device 3 + negative control interlab study
  • Device 3 (number 5) showed a low GFP expression, so it was tried to re-preform the tranformation. Negative control of the interlab (number 1) was not performed last time due to lack of LBC plates so was also performed.
  • Protocol Transformation
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb

21/08/18

The Cu-promotor (pSB1K3) and RFP (pSB1K3) were transformed from the kit according to the protocol. The bacteria were plated in 100% and 500%. The custom receptor was ordered and put in the pBSK vector

22/08/18

Bacteria grown and colonies were picked and inoculated in 5 ml LB with

  • Cu-promotor (pSB1K3) = Kanamycin
  • RFP (pSB1K3) = Kanamycin
  • Custom Receptor pBSK = Ampicillin

23/08/18

Miniprep was performed according to the protocol

  • Cu-promotor → 250
  • Custom receptor → 360
  • RFP → 91.7

The “dirty” method of cloning was used to couple the Cu-Promotor and RFP in one vector. The custom receptor was transformed to another vector (pSBK)

For each of the three samples a mastermix was made. For each digestion the DNA concentration was reduced to 25 ng/ul. 4 ul of sample was transferred to a PCR tube with 4 ul of the according restriction mix. The samples were incubated for 1 hour at 37 C. After 1 hour the samples were taken out of the incubator and enzymes were heat inactivated at 80C for 20 min. 1ul of Cu-promotor and 1ul of RFP were added to one PCR tube. Furthermore 1ul DNA T4 ligase buffer and 0.5 ul of T4 ligase were added. The total volume was made up to 10 ul with 3.5 ul dH2O. The samples were incubated for one hour (RT). Enzymes were deactivated with heat kill 80C 20 min.

DNA was transformed in DH5a according to the NEB protocol.

24/08/18

Transformation was successful. Colonies were picked for colony PCR to identify whether the right construct was transformed. 8 colonies of each plate were selected (Cu-promotor + RFP 100%, Cu-promotor + RFP 500%, Custom receptor 100, Custom Receptor 500). Each colony was incubated in PCR tubes with 50 ul LB without antibiotic for 1 hour.

27/08/18

Samples from prior colony PCR were analysed with a 0.8% Agar gel electrophoresis.

1-8 Custom receptor 100%
9-16 Custom receptor 500%
17-24 Cu + RFP 100%
25-32 Cu + RFP 500%

28/08/18

The results obtained in the gel electrophoresis DNA analysis (27/8/18) was not satisfactory. Therefore four new colonies were picked for colony PCR and put in 50 µl LB and incubated for 1 hour from each of the following plates: Cu + RFP 100%, Cu + RFP 500%, Custom Receptor 100%, Custom Receptor 500%. 2 µl was of each pick was transferred to new PCR tubes with the 18 µl of following mix:

Content Volume (µl)
Pol TAQ 0.1
buffer 4
dNTP 0.4
Forward primer 0.4
Revere primer 0.4
H2O 12.7

29/08/18

The DNA of the (28/08/18) samples was purified according to the miniprep protocol.

Sample Concentration ng/µl Description
jan-00 69.9 Cu-Promotor+ RFP
9 77.5 Custom receptor
12 91.8 Custom Receptor
13 49.4 Custom Receptor
14 85.4 Custom Receptor

The prior prepared clonation (28/08/18) was transformed in DH5α according to the iGEM protocol.

30/08/18

No colonies of the transformation(29/8/18) were observed on the petri dishes.

The purified DNA of samples 4,12,14 (29/8/18) were send for sequencing with forward and reverse primer.

Custom receptor in PBSK3

05/09/18

Samples from sequencing were analysed. Custom receptor (12) was placed in the PBSK3 backbone correctly. The sequence of Cu + RFP was difficult to interpret. Therefore Cu + RFP (4) was incubated again in 5 ml LB + Ampicillin from the safe overnight.

06/09/18

The Cu + RFP DNA was purified according to the protocol with minor modifications. The bacteria were split up in fractions of 1.5 ml and pelleted at full speed (21 000 RCF) for one minute. Supernatant was discarded and 150 µl buffer A1 was added. The pellets were resuspended and 250 µl lysis buffer was added. The eppendorfs were tilted 5 times and incubated for 2 min. 450 µl buffer A3 was added and tilted till the blue color disappeared. The fractions were pelleted (21 000 RCF 1 min). The supernatant of all three samples was loaded on one column. The rest of the experiment was performed as described in the protocol. The DNA was eventually solubilised in 20 µl elution buffer at 60 degrees celsius. The final concentration was 463 µg/ml. The sample was sent for sequencing in a 500 ng concentration with VF and VR primer.

Cu + RFP (4) Code: Primer
1BA9ZAB414 VF
1BA9ZAB413 VR

10/09/18

The sequence of Cu + RFP did not contain the copper promotor, only RFP.

11/09/18

New method of cloning was tried. We wanted to place the RFP into the Cu promotor PSBK backbone. To do this, digestion was performed according to the NEB digestion protocol. The cu promotor was cut with SpeI and PstI, RFP was cut with Xbal and PstI. After heat inactivation the samples were placed in the -20 freezer

12/09/18

The prior cut samples were ligated using the NEB protocol. 2.4 µl RFP was used as insert with 1 µl of Cu promotor backbone. After heat inactivation the sample was transformed according to the iGEM protocol in DH5α and plated on Ampicillin plates.

13/09/18

Transformation was successful.

18/09/18

16 colonies were picked for colony PCR using one-Taq polymerase and a safe of these colonies was made. The PCR samples were loaded on a 0.8% agarose gel. The gel did not contain a successful cloning sample.

24/09/18

We decided to use another approach,since our previous attempts didn’t yield any results. The copper promoter gBlock was cut with the restriction enzymes EcoRI and SpeI. Simultaneously, the RFP vector was cut with EcoRI and XbaI. Both reactions were done overnight in NEB Buffer 2.1.

25/09/18

In the morning the reaction mix was inactivated by heating it to 80 degrees for 20 minutes. A ligation was set up with the fragments, and 9 µl of the ligation product was transformed to 100 µl of competent Dh5a.

26/09/18

The transformation was successful. 6 colonies could be spotted. These were inoculated overnight in 5 ml LB with chloramphenicol.

27/09/18

The DNA of the inoculated cultures was minipreped according to the miniprep protocol. After the first spin down we noticed that the bacterial pellet of one of the colonie number 6 was slightly red. Because it is known that RFP expressing bacteria turn red even without excitation, we concluded that it was most likely that this colony expressed RFP, and thus that the transformation worked. After the isolation of the DNA, a colony PCR was done with the VF and VR primer. The total size of the band that we expected was 824+156 -6 = 974 bp for the fragment + 271 bp for the part outside the BB_sites generated by the VF and VR primer. The total size of the fragment should thus be 1245 bp. The fragment in lane 6 lies between the 1000 bp band and the 1500 bp band and starts slightly lower than the middle, indicating that it is most likely a band of correct size.

The DNA of this colony was send for sequencing.

29/09/18

The sequencing results showed that the construct was correct. Since both the promoter::RFP fusion, and the Custom receptor were now available to us on plasmid backbones with different resistance genes, both constructs were transformed to E. coli Dh5a.

30/09/18

The transformation was successful. A stock solution of 50 mM CuSO4 was made for experiments with the newly transformed copper sensitive bacteria. 2 colonies were inoculated overnight for further experiments.

01/10/18

100 µl of the overnight cultures from 18/09/30 was transferred to two tubes containing 5 ml of clean LB. One tube contained 500 µM CuSO4. Both tubes were inoculated for 45 minutes at 37 degrees. 400 µl of this culture was washed in 1 ml of PBS and RFP expression was measured with an emission scan between 570 and 640 nm in a Carry Eclipse Fluorescence Photospectrometer using 400 µl of the copper bacterium containing PBS solution. The excitation wavelength used was 555 nm. No fluorescence could be measured, which was probably due to the low amount of bacteria.

02/10/18

A new overnight inoculation of the double transformed bacteria was made.

03/10/18

The experiment of 18/10/01 was repeated, but this time CuSO4 was added to the inoculation at a final concentration of 500 µM, 250 µM, 50 µM, and 5 µM, or 0 µM. The Bacteria were inoculated for 2 hrs at 37 degrees.

30/07/18

Isolated biobricks (listed in Table 1) and transformed them to E. coli Dh5ɑ according to the transformation protocol.

Biobrick Kit location* Part name Part size (bp)
BBa_K608003 1/5A Promoter +RBS 56
BBa_K569017 1/8K CheY 390
BBa_K629003 1/18G CheZ 644
BBa_I759001 3/3J Rluc 936
BBa_B0017 3/6C Terminator 128 **
BBa_I15017 4/21N eYFP 717

* location name is as follows: plate number/well number (e.g. 1/5A means plate 1 well 5A)
** this part contains two copies of BBa_B0010 (64 bp each) but the exact size of the fragment is unspecified on the wiki page.

31/07/18

Checked for colonies of the transformations from 30/07/18. Single colonies were picked from each plate and inoculated according to the inoculation protocol.

01/08/18 (morning)

Isolated the plasmids containing the biobricks from the inoculated colonies from 31/07/18 according to the plasmid purification protocol. (for concentrations see Table 2)

Concentration (ug/ml)
Biobrick Kit location* Part name Replicate 1 Replicate 2
BBa_K608003 1/5A Promoter +RBS 76,8 77,8
BBa_K569017 1/8K CheY 51 50,5
BBa_K629003 1/18G CheZ 83,1 111,9
BBa_I759001 3/3J Rluc 81,2 89,7
BBa_B0017 3/6C Terminator 137,8 75,4
BBa_I15017 4/21N eYFP 70 70,9

01/08/18 (afternoon)

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, CheZ, Rluc, eYFP so that they can be used for Gibson assembly later in the project. The primers used are listed in Table 3.

Part Primer name Primer sequence 5’--> 3’
CheZ CheZ_F1 gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
CheZ_R1 CCTTGGAAGCCATTCCACCTCCACCTCCAAATCCAAGACTATCCAACAAATCG
Rluc Rluc_F1 AGTCTTGGATTTGGAGGTGGAGGTGGAATGGCTTCCAAGGTGTACG     
Rluc_R1 tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag
eYFP YFP_F1      gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
YFP_R1      CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG    
CheY CheY_F1      CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG         
CheY_R1     tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

02/08/18 (morning)

Performed a gel electrophoresis on the PCR product from 01/08/18 on a 1.5% agarose gel according to the gel electrophoresis protocol (Figure 1). And purified the bands from gel as described in the gel purification protocol.

PCR product Concentration (ug/ml)
CheY /
Rluc 45,6
CheZ 59,9
eYFP 26,6

Since the PCR of CheY didn’t succeeded and the concentration of eYFP was very low, we decided to do these PCRs again.

02/08/18 (afternoon)

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, eYFP, LuxA, and LuxB using the primers listed in Table 5.

03/08/18

Figured out that the LuxA and LuxB fragments would contain a double m13 forward site and a double T3 site if PCR product was used. Decided to PCR LUXA and LuxB from gBlock. Ran the PCR product on gel (figure 3) and extracted the correct bands.

ksjdfljslfkdjlkghjfglhkjflhgkjflhgjflghjflghkjflhj
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb