Team:Utrecht/Notebook

Receptor Assay

August
September
October

BRET Assay

July
August
September

Methylation Assay

July
August
September
Mo
Tu
We
Th
Fr
Sa
Su

Morning

Performed Calibration 1, 2, and 3 according to protocol. All measurements were performed using the plate reader of Seino.

Table 1. content 96 wells plate cal.1 and cal.2
123456789101112
ALdd
BLdd
CLdd
DLdd
E MSdddddddddddd dddddddddd
FMSdddddddddddd dddddddddd
G MSdddddddddddddddddddddd
H MSdddddddddddddddddddddd
Calibration 1
  • L= 100 uL Ludox CL-X (stored at 4C)
  • dd= 100 uL ddH20
  • Measurement: Abs600, turn off pathlength correction
Calibration 2
  • MS= 200 ul Microsphere Stock Solution
  • dd= 100 uL ddH20
  • green= serial dilution was performed with a micropipet from E1,F1,G1,H1 - E11,F11,G11,H11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: Abs600, re-mix befor putting in plate reader and prevent bubbles, path length correction off
Calibration 3
  • 1xFC= 200 mL 1xFC (100uL 10x fluorescein + 900ul 1x PBS pH 7.4, tube was covered with foil
  • P= 100 uL 1x PBS pH 7.4
  • green= serial dilution was performed with a micropipet from A1,B1,C1,D1 - A11,B11,C11,D11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: FL, 530nm/30nm bandpass, 25-30nm with recommened excitation of 485nm, emission 520-530nm of the filter. Path length correction was turned off
Table 2. content 96 wells plate cal.3
123456789101112
A1xFCPPPPPPPPPPP
B1xFCPPPPPPPPPPP
C1xFCPPPPPPPPPPP
D1xFCPPPPPPPPPPP
E
F
G
H

Afternoon

LBC plates were made according to the protocol used on the wall
  • 250ml LB 2x added to melted 250 ml WA 2x using a microwave
  • 0.5ml was added to final solution
  • plates were dried in 37C incubator
Transformation device 3 + negative control interlab study
  • Device 3 (number 5) showed a low GFP expression, so it was tried to re-preform the tranformation. Negative control of the interlab (number 1) was not performed last time due to lack of LBC plates so was also performed.
  • Protocol Transformation
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb

21/08/18

1/9M (RFP) was transformed from the iGEM kit according to the protocol. The coding sequence of the custom receptor, and copper promoter flanked by biobrick sites were ordered from IDT and used directly.

22/08/18

Transformation was successful and a colony was picked and inoculated in chloramphenicol.

24/08/18

Transformation was successful 8 colonies were picked to perform colony PCR according to the protocol. (Cu-promotor::RFP 100%, Cu-promotor::RFP 500%, Custom receptor 100%, Custom Receptor 500%).

Note: The date on the plates is date of preparation not transformation

27/08/18

Samples from colony PCR (18/08/24) were analysed with a 0.8% Agar gel electrophoresis.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

1-8 Custom receptor 100%
9-16 Custom receptor 500%
17-24 Cu + RFP 100%
25-32 Cu + RFP 500%

28/08/18

The results obtained in the gel electrophoresis DNA analysis (27/8/18) was not satisfactory. Therefore four new colonies were picked for colony PCR in accordance with the protocol.

1-4 Cu::RFP 100% 5-8 Cu::RFP 500% 9-12 Custom receptor 100% 13-16 Custom receptor 500%

The PCR samples were analysed with gel elektrophorese using 0.8% agarose gel.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

Samples 4, 9, 12, 13, 14 were selected and inoculated in 5 ml LB containing kanamycin overnight. A safe of these samples was made as well.

As the Cu::RFP sample did not yield the desired results, new cloning procedure was initiated using the iGEM protocol and buffer 2.1 instead of enzyme specific buffers. In order to ensure that we would have enough genetic material, we cloned the gBlock `copper-promoter blunt into the vector pBSK.

29/08/18

The DNA of the (28/08/18) samples was purified according to the miniprep protocol.

Sample Concentration ng/µl Description
jan-00 69.9 Cu-Promotor+ RFP
9 77.5 Custom receptor
12 91.8 Custom Receptor
13 49.4 Custom Receptor
14 85.4 Custom Receptor

The prior prepared clonation (28/08/18) was transformed in DH5α according to the iGEM protocol.

Safe made from samples Samples 4, 9, 12, 13, 14 (18/08/28)

30/08/18

No colonies of the transformation(29/8/18) were observed.

The purified DNA of samples 4,12,14 (29/8/18) were send for sequencing with forward and reverse primer.

05/09/18

Samples from sequencing were analysed. Custom receptor (12) was placed in the pSB1K3 backbone correctly. The sequence of Cu-promoter::RFP was difficult to interpret. Therefore Cu-promoter::RFP (4) was incubated again in 5 ml LB + Kanamycin from the safe overnight.

06/09/18

The Cu::RFP DNA was purified according to the miniprep protocol with 5 ml bacteria instead of 1.5 ml and eluted in 20 µl elution buffer. DNA was sent for sequencing.

Cu + RFP (4) Code: Primer
1BA9ZAB414 VF
1BA9ZAB413 VR

10/09/18

The sequence of Cu::RFP did not contain the copper promotor, only RFP.

11/09/18

The RFP DNA was cloned into the Copper-promoter vector by cutting the copper-promoter vector with SpeI and PstI, and the RFP vector with XbaI and PstI overnight at 37 °C.

12/09/18

The prior cut samples were ligated. 2.4 µl RFP DNA was used as insert with 1 µl of Cu promotor backbone. After heat inactivation the sample was transformed according to the iGEM protocol in DH5α and plated on Ampicillin plates.

13/09/18

Transformation was successful. However, close examination of the samples under the fluorescence binoculars revealed that none of the colonies expressed RFP.

2 colonies were picked and inoculated in 5 ml LB + ampicillin.

22/09/18

Since our previous attempts didn’t yield any results we decided to place the copper promoter gBlock was cut with the restriction enzymes EcoRI and SpeI. Simultaneously, the RFP vector (PSB1C3) was cut with EcoRI and XbaI. Both reactions were done overnight in NEB Buffer 2.1.

23/09/18

The digestion product from 18/09/22 was ligated according to the iGEM ligation protocol. 2 µl of ligation product was transformed to E. coli DH5α. .

24/09/18

The reaction mix was inactivated by heating it to 80 degrees for 20 minutes. A ligation was set up with the fragments, and 9 µl of the ligation product was transformed to 100 µl of competent DH5α.

25/09/18

The transformation was successful. 6 colonies could be spotted. These were inoculated overnight in 5 ml LB with chloramphenicol.

26/09/18

The DNA of the inoculated cultures was minipreped according to the miniprep protocol. After the first spin down we noticed that the bacterial pellet of one of the colonie number 6 was slightly red. Because it is known that RFP expressing bacteria turn red even without excitation, we concluded that it was most likely that this colony expressed RFP, and thus that the transformation worked. After the isolation of the DNA, a colony PCR was done with the VF and VR primer. The total size of the band that we expected was 824+156 -6 = 974 bp for the fragment + 271 bp for the part outside the BB_sites generated by the VF and VR primer. The total size of the fragment should thus be 1245 bp. The fragment in lane 6 lies between the 1000 bp band and the 1500 bp band and starts slightly lower than the middle, indicating that it is most likely a band of correct size.

The DNA of this colony was send for sequencing.

29/09/18

The sequencing results showed that the construct was correct. Since both the promoter::RFP fusion, and the Custom receptor were now available to us on plasmid backbones with different resistance genes, both constructs were transformed to E. coli Dh5a.

30/09/18

The transformation was successful. A stock solution of 50 mM CuSO4 was made for experiments with the newly transformed copper sensitive bacteria. 2 colonies were inoculated overnight for further experiments.

01/10/18

100 µl of the overnight cultures from 18/09/30 was transferred to two tubes containing 5 ml of clean LB. One tube contained 500 µM CuSO4. Both tubes were inoculated for 45 minutes at 37 degrees. 400 µl of this culture was washed in 1 ml of PBS and RFP expression was measured with an emission scan between 570 and 640 nm in a Carry Eclipse Fluorescence Photospectrometer using 400 µl of the copper bacterium containing PBS solution. The excitation wavelength used was 555 nm. No fluorescence could be measured, which was probably due to the low amount of bacteria.

02/10/18

A new overnight inoculation of the double transformed bacteria was made.

03/10/18

The experiment of 18/10/01 was repeated, but this time CuSO4 was added to the inoculation at a final concentration of 500 µM, 250 µM, 50 µM, and 5 µM, or 0 µM. The Bacteria were inoculated for 2 hrs at 37°C.

12/10/18

The following bacteria (DH5α) were inoculated in 5 ml minimal medium, and 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

13/10/18

Bacteria in minimal medium did not grow. Cu-promoter::RFP // Custom receptor samples were red coloured while bacteria not containing the custom receptor were yellowish. Fluorescence images were taken to confirm RFP expression. The bacteria containing the Cu-promoter::RFP // Custom receptor were washed 1x in M9 and incubated again overnight in M9 containing 0.4% glucose.

In order to confirm aspartic acid induced RFP expression the experiment was repeated. The following bacteria (DH5α) were inoculated in 5 ml M9 + 0.4% glucose, and in 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

14/10/18

Bacteria in M9 did not grow. Bacteria in LB did grow but did not express GFP observed with the naked eye. 4 ml bacteria of each of the two samples was washed with 1x with M9 and incubated with M9 + 0.4% glucose.

After 4 hours of incubation in M9 + 0.4% glucose the samples were split up in the following fractions. After 4 hours 500 μl was used for fluorescence measurements using the prior described fluorescence photospectrometer (ex. 585 nm). After 7 hours the remaining 500 μl was used for measurements.

Asp (10 μ 50 mM) Cu (2 μl 25 mM)
Sample
Custom Receptor 1 + -
Custom Receptor 2 - -
Cu-promoter :: RFP 3 + -
Cu-Promoter :: RFP 4 - +
Cu-Promoter :: RFP 5 - -

Sample 1 is not representative at 8 hours since the remaining volume of bacteria was less than the volume in the cuvette. Therefore this sample was diluted which resulted in a increased intensity as the cuvette was now fully filled, however, the measurement did not reach its full potential.

The Cu-promoter::RFP // Custom receptor sample washed (18/10/13) and incubated overnight was split up in two 4 ml fractions. To one fraction 40 μl 50 mM Aspartic acid was added and incubated for 4 hours. After 4 hours 500 μl was used for fluorescence measurements, this was repeated at 8 and 11 hours

30/07/18

Isolated biobricks (listed in Table 1) and transformed them to E. coli Dh5ɑ according to the transformation protocol.

Biobrick Kit location* Part name Part size (bp)
BBa_K608003 1/5A Promoter +RBS 56
BBa_K569017 1/8K CheY 390
BBa_K629003 1/18G CheZ 644
BBa_I759001 3/3J Rluc 936
BBa_B0017 3/6C Terminator 128 **
BBa_I15017 4/21N eYFP 717

* location name is as follows: plate number/well number (e.g. 1/5A means plate 1 well 5A)
** this part contains two copies of BBa_B0010 (64 bp each) but the exact size of the fragment is unspecified on the wiki page.

31/07/18

Checked for colonies of the transformations from 30/07/18. Single colonies were picked from each plate and inoculated according to the inoculation protocol.

01/08/18 (morning)

Isolated the plasmids containing the biobricks from the inoculated colonies from 31/07/18 according to the plasmid purification protocol. (for concentrations see Table 2)

Concentration (ug/ml)
Biobrick Kit location* Part name Replicate 1 Replicate 2
BBa_K608003 1/5A Promoter +RBS 76,8 77,8
BBa_K569017 1/8K CheY 51 50,5
BBa_K629003 1/18G CheZ 83,1 111,9
BBa_I759001 3/3J Rluc 81,2 89,7
BBa_B0017 3/6C Terminator 137,8 75,4
BBa_I15017 4/21N eYFP 70 70,9

01/08/18 (afternoon)

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, CheZ, Rluc, eYFP so that they can be used for Gibson assembly later in the project. The primers used are listed in Table 3.

Part Primer name Primer sequence 5’--> 3’
CheZ CheZ_F1 gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
CheZ_R1 CCTTGGAAGCCATTCCACCTCCACCTCCAAATCCAAGACTATCCAACAAATCG
Rluc Rluc_F1 AGTCTTGGATTTGGAGGTGGAGGTGGAATGGCTTCCAAGGTGTACG     
Rluc_R1 tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag
eYFP YFP_F1      gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
YFP_R1      CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG    
CheY CheY_F1      CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG         
CheY_R1     tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

02/08/18 (morning)

Performed a gel electrophoresis on the PCR product from 01/08/18 on a 1.5% agarose gel according to the gel electrophoresis protocol (Figure 1). And purified the bands from gel as described in the gel purification protocol.

PCR product Concentration (ug/ml)
CheY /
Rluc 45,6
CheZ 59,9
eYFP 26,6

Since the PCR of CheY didn’t succeeded and the concentration of eYFP was very low, we decided to do these PCRs again.

02/08/18 (afternoon)

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, eYFP, LuxA, and LuxB using the primers listed in Table 5.

03/08/18

Figured out that the LuxA and LuxB fragments would contain a double m13 forward site and a double T3 site if PCR product was used. Decided to PCR LUXA and LuxB from gBlock. Ran the PCR product on gel (figure 3) and extracted the correct bands.

06/08/18

Performed gibson assembly according to the gibson assembly protocol on the DNA pairs as listed in table 6. “wrong” LuxA and LuxB, the “correct” LuxA and LuxB, and CheZ and Rluc. Transformed 9 µl of each Gibson product to 100 µl of DH5ɑ in order to increase the amount of successful colonies.

07/08/18

Performed a colony PCR on each plate from 06/08/18. Picked 2 colonies from each plate. Inoculated bacteria containing inserts of the correct size.

08/08/18

Isolated DNA from inoculations from 07/08/18 and sended them for sequencing.

09/08/18

Performed PCR to create the correct overhang for gibson cloning on CheY.

10/08/18

Ran PCR product from 09/08/18 on gel and isolated the DNA using the Gel purification protocol

15/08/18

Performed a gibson reaction to assemble eYFP-CheY and transformed the product to DH5-alpha.

16/08/18

Performed a colony PCR on colonies of 15/08/18 for eYFP-CheY, and additional CheZ-Rluc from 07/08/18 since the sequencing results of 08/08/18 showed a deletion in the BB_SF site. Made a plate containing the positive colonies and inoculated them overnight.

17/08/18

Isolated the eYFP-CheY DNA from the inoculations of 16/08/18 Concentrations were as described in Table 7

Inoculation from colony Concentration (ng/µl)
1 224.5
2 277.5
3 334.4
4 280.4

20/08/18

Send the isolated eYFP-CheZ DNA from 17/08/18 for sequencing using the M13FW and M13Rev primer.

27/08/18

Reverse Primer CheY reverse CheY reverse Reverse 2 M13 reverse CheZ reverse, luxAB overhang eYFP reverse
DNA Forward Primer
1. CheY (kit) Long Forward
2. CheY (kit) Short forward
3. CheY (Gblock) GblockCheY forward
4. LuxAB LuxAB forward, CheZ overhang
5. CheZ (kit) CheZ forward 1
6. eYFP eYFP forward
ksjdfljslfkdjlkghjfglhkjflhgkjflhgjflghjflghkjflhj
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb
Project Design
Results
Protocols