Team:Utrecht/Notebook

Receptor Assay

August
September
October

BRET Assay

July
August
September
October

Methylation Assay

July
August
September
Mo
Tu
We
Th
Fr
Sa
Su

Morning

Performed Calibration 1, 2, and 3 according to protocol. All measurements were performed using the plate reader of Seino.

Table 1. content 96 wells plate cal.1 and cal.2
123456789101112
ALdd
BLdd
CLdd
DLdd
E MSdddddddddddd dddddddddd
FMSdddddddddddd dddddddddd
G MSdddddddddddddddddddddd
H MSdddddddddddddddddddddd
Calibration 1
  • L= 100 uL Ludox CL-X (stored at 4C)
  • dd= 100 uL ddH20
  • Measurement: Abs600, turn off pathlength correction
Calibration 2
  • MS= 200 ul Microsphere Stock Solution
  • dd= 100 uL ddH20
  • green= serial dilution was performed with a micropipet from E1,F1,G1,H1 - E11,F11,G11,H11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: Abs600, re-mix befor putting in plate reader and prevent bubbles, path length correction off
Calibration 3
  • 1xFC= 200 mL 1xFC (100uL 10x fluorescein + 900ul 1x PBS pH 7.4, tube was covered with foil
  • P= 100 uL 1x PBS pH 7.4
  • green= serial dilution was performed with a micropipet from A1,B1,C1,D1 - A11,B11,C11,D11 by a volume of 100uL. Before every transfer solution was pipetted up and down 3x, after every transfer tips were discharged.
  • Measurement: FL, 530nm/30nm bandpass, 25-30nm with recommened excitation of 485nm, emission 520-530nm of the filter. Path length correction was turned off
Table 2. content 96 wells plate cal.3
123456789101112
A1xFCPPPPPPPPPPP
B1xFCPPPPPPPPPPP
C1xFCPPPPPPPPPPP
D1xFCPPPPPPPPPPP
E
F
G
H

Afternoon

LBC plates were made according to the protocol used on the wall
  • 250ml LB 2x added to melted 250 ml WA 2x using a microwave
  • 0.5ml was added to final solution
  • plates were dried in 37C incubator
Transformation device 3 + negative control interlab study
  • Device 3 (number 5) showed a low GFP expression, so it was tried to re-preform the tranformation. Negative control of the interlab (number 1) was not performed last time due to lack of LBC plates so was also performed.
  • Protocol Transformation
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb

21/08/18

Lorenzo

1/9M (RFP) was transformed from the iGEM kit according to the protocol. The coding sequence of the custom receptor, and copper promoter flanked by biobrick sites were ordered from IDT and used directly.

22/08/18

Lorenzo

Transformation was successful and a colony was picked and inoculated in chloramphenicol.

23/08/18

Felix, Lorenzo

Miniprep was performed according to the protocol.
Cu-promotor → 250 ng/μl
Custom receptor → 360 ng/μl
RFP → 91.7 ng/μl

Cu-promoter and RFP were placed in pSB1K3, custom receptor was placed in pSB1K3 as well. Cu-promoter DNA was digested with EcoRI and SpeI, RFP DNA was digested with XbaI and PstI. The custom receptor and the target-vector were digested with EcoRI and PstI.

For each of the three samples a mastermix was made. For each digestion the DNA concentration was reduced to 25 ng/ul. 4 ul of DNA sample and target vector sample were transferred to a PCR tube with 4 ul of the according restriction mix. The samples were incubated for 1 hour at 37 C. After 1 hour the samples were taken out of the incubator and enzymes were heat deactivated at 80C for 20 min. 1ul of target vector (pSB1K3), 2 ul of Cu-promotor restricted DNA, and 2 ul restricted RFP DNA were added to one PCR tube. Furthermore 1ul DNA T4 ligase buffer and 0.5 ul of T4 ligase were added. The total volume was made up to 10 ul with 3.5 ul dH2O. The samples were incubated for one hour (RT). Enzymes were deactivated with heat kill 80C 20 min.

DNA was transformed in DH5a according to the iGEM protocol.

24/08/18

Lorenzo

Transformation was successful 8 colonies were picked to perform colony PCR according to the protocol. (Cu-promotor::RFP 100%, Cu-promotor::RFP 500%, Custom receptor 100%, Custom Receptor 500%).



Note: The date on the plates is date of preparation not transformation

27/08/18

Felix

Samples from colony PCR (24/08/18) were analysed with a 0.8% Agar gel electrophoresis.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

1-8 Custom receptor 100%
9-16 Custom receptor 500%
17-24 Cu::RFP 100%
25-32 Cu::RFP 500%

28/08/18

Lorenzo, Felix

The results obtained in the gel electrophoresis DNA analysis (27/8/18) was not satisfactory. Therefore four new colonies were picked for colony PCR in accordance with the protocol.

1-4 Cu::RFP 100%
5-8 Cu::RFP 500%
9-12 Custom receptor 100%
13-16 Custom receptor 500%

The PCR samples were analysed with gel electrophoresis using 0.8% agarose gel.
Custom receptor = 1926 bp
Cu-promoter::RFP = 1238 bp

Samples 4, 9, 12, 13, 14 were selected and inoculated in 5 ml LB containing kanamycin overnight. A safe of these samples was made as well.

As the Cu::RFP sample did not yield the desired results, new cloning procedure was initiated using the iGEM protocol and buffer 2.1 instead of enzyme specific buffers. In order to ensure that we would have enough genetic material, we cloned the gBlock `copper-promoter blunt into the vector pBSK.

29/08/18

Felix

The DNA of the (28/08/18) samples was purified according to the miniprep protocol.

Sample Concentration ng/µl Description
1 - 8 69.9 Cu-Promotor+ RFP
9 77.5 Custom receptor
12 91.8 Custom Receptor
13 49.4 Custom Receptor
14 85.4 Custom Receptor

The prior prepared clonation (28/08/18) was transformed in DH5α according to the iGEM protocol.

Safe made from samples Samples 4, 9, 12, 13, 14 (08/28/18)

30/08/18

Felix

No colonies of the transformation(29/8/18) were observed.

The purified DNA of samples 4,12,14 (29/8/18) were send for sequencing with forward and reverse primer.

05/09/18

Lorenzo

Samples from sequencing were analysed. Custom receptor (12) was placed in the pSB1K3 backbone correctly. The sequence of Cu-promoter::RFP was difficult to interpret. Therefore Cu-promoter::RFP (4) was incubated again in 5 ml LB + Kanamycin from the safe overnight.

06/09/18

Jolijn

The Cu::RFP DNA was purified according to the miniprep protocol with 5 ml bacteria instead of 1.5 ml and eluted in 20 µl elution buffer. DNA was sent for sequencing.

Cu + RFP (4) Code: Primer
1BA9ZAB414 VF
1BA9ZAB413 VR

10/09/18

Lorenzo

The sequence of Cu::RFP did not contain the copper promotor, only RFP.

11/09/18

Lorenzo

The RFP DNA was cloned into the Copper-promoter vector by cutting the copper-promoter vector with SpeI and PstI, and the RFP vector with XbaI and PstI overnight at 37 °C.

12/09/18

Felix

The prior cut samples were ligated. 2.4 µl RFP DNA was used as insert with 1 µl of Cu promotor backbone. After heat inactivation the sample was transformed according to the iGEM protocol in DH5α and plated on Ampicillin plates.

13/09/18

Lorenzo

Transformation was successful. However, close examination of the samples under the fluorescence binoculars revealed that none of the colonies expressed RFP.

2 colonies were picked and inoculated in 5 ml LB + ampicillin.

22/09/18

Lorenzo

Since our previous attempts didn’t yield any results we decided to place the copper promoter gBlock was cut with the restriction enzymes EcoRI and SpeI. Simultaneously, the RFP vector (PSB1C3) was cut with EcoRI and XbaI. Both reactions were done overnight in NEB Buffer 2.1.

23/09/18

Lorenzo

The digestion product from 09/22/18 was ligated according to the iGEM ligation protocol. 2 µl of ligation product was transformed to E. coli DH5α.

24/09/18

Lorenzo

The reaction mix was inactivated by heating it to 80 degrees for 20 minutes. A ligation was set up with the fragments, and 9 µl of the ligation product was transformed to 100 µl of competent DH5α.

25/09/18

Felix

The transformation was successful. 6 colonies could be spotted. These were inoculated overnight in 5 ml LB with chloramphenicol.

26/09/18

Lorenzo, Felix

The DNA of the inoculated cultures was minipreped according to the miniprep protocol. After the first spin down we noticed that the bacterial pellet of one of the colonie number 6 was slightly red. Because it is known that RFP expressing bacteria turn red even without excitation, we concluded that it was most likely that this colony expressed RFP, and thus that the transformation worked. After the isolation of the DNA, a colony PCR was done with the VF and VR primer. The total size of the band that we expected was 824 + 156 -6 = 974 bp for the fragment + 271 bp for the part outside the BB_sites generated by the VF and VR primer. The total size of the fragment should thus be 1245 bp. The fragment in lane 6 lies between the 1000 bp band and the 1500 bp band and starts slightly lower than the middle, indicating that it is most likely a band of correct size.

The DNA of this colony was send for sequencing.

29/09/18

Lorenzo

The sequencing results showed that the construct was correct. Since both the promoter::RFP fusion, and the Custom receptor were now available to us on plasmid backbones with different resistance genes, both constructs were transformed to E. coli Dh5a.

30/09/18

Lorenzo, Felix

The transformation was successful. A stock solution of 50 mM CuSO4 was made for experiments with the newly transformed copper sensitive bacteria. 2 colonies were inoculated overnight for further experiments.

01/10/18

Lorenzo

100 µl of the overnight cultures from 09/30/18 was transferred to two tubes containing 5 ml of clean LB. One tube contained 500 µM CuSO4. Both tubes were inoculated for 45 minutes at 37 degrees. 400 µl of this culture was washed in 1 ml of PBS and RFP expression was measured with an emission scan between 570 and 640 nm in a Carry Eclipse Fluorescence Photospectrometer using 400 µl of the copper bacterium containing PBS solution. The excitation wavelength used was 555 nm. No fluorescence could be measured, which was probably due to the low amount of bacteria.

02/10/18

Jolijn

A new overnight inoculation of the double transformed bacteria was made.

03/10/18

Felix, Lorenzo

The experiment of 10/01/18 was repeated, but this time CuSO4 was added to the inoculation at a final concentration of 500 µM, 250 µM, 50 µM, and 5 µM, or 0 µM. The Bacteria were inoculated for 2 hrs at 37°C.

12/10/18

Felix

The following bacteria (DH5α) were inoculated in 5 ml minimal medium, and 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

13/10/18

Jolijn, Felix, Lorenzo

Bacteria in minimal medium did not grow. Cu-promoter::RFP // Custom receptor samples were red coloured while bacteria not containing the custom receptor were yellowish. Fluorescence images were taken to confirm RFP expression. The bacteria containing the Cu-promoter::RFP // Custom receptor were washed 1x in M9 and incubated again overnight in M9 containing 0.4% glucose.

In order to confirm aspartic acid induced RFP expression the experiment was repeated. The following bacteria (DH5α) were inoculated in 5 ml M9 + 0.4% glucose, and in 5 ml LB with matching antibiotic.

Cu-promotor::RFP // Custom receptor → Ampicillin, Chloramphenicol
Cu-promotor::RFP → Chloramphenicol

Cu-promoter :: RFP Normarski

Cu-promoter :: RFP Nomarski Fluorescence

Cu-promoter :: RFP // Custom receptor

Cu-promoter::RFP // Custom receptor fluorescence (falsely coloured)

14/10/18

Felix, Jolijn

Bacteria in M9 did not grow. Bacteria in LB did grow but did not express GFP observed with the naked eye. 4 ml bacteria of each of the two samples was washed with 1x with M9 and incubated with M9 + 0.4% glucose.

After 4 hours of incubation in M9 + 0.4% glucose the samples were split up in the following fractions. After 4 hours 500 μl was used for fluorescence measurements using the prior described fluorescence photospectrometer (ex. 585 nm). After 7 hours the remaining 500 μl was used for measurements.

Sample Asp (10 μ 50 mM) Cu (2 μl 25 mM)
Custom Receptor 1 + -
Custom Receptor 2 - -
Cu-promoter :: RFP 3 + -
Cu-Promoter :: RFP 4 - +
Cu-Promoter :: RFP 5 - -

Sample 1 is not representative at 8 hours since the remaining volume of bacteria was less than the volume in the cuvette. Therefore this sample was diluted which resulted in a increased intensity as the cuvette was now fully filled, however, the measurement did not reach its full potential.

The Cu-promoter::RFP // Custom receptor sample washed (10/13/18) and incubated overnight was split up in two 4 ml fractions. To one fraction 40 μl 50 mM Aspartic acid was added and incubated for 4 hours. After 4 hours 500 μl was used for fluorescence measurements, this was repeated at 8 and 11 hours

Although these data are not conclusive it indicates that the custom receptor has a reaction on the addition of aspartate. Therefore new samples were inoculated in 5 ml LB.

Custom // Cu-promoter :: RFP 3x
Custom // Cu-promoter :: RFP Asp+ 500  μM 1x
Cu-promoter :: RFP 3x
Cu-promoter :: RFP  Asp+ 500 μM 1x
Cu-promoter :: RFP 50 μM CuSO4 1x

30/07/18

Isolated biobricks (listed in table below) and transformed them to E. coli Dh5ɑ according to the transformation protocol.

Biobrick Kit location* Part name Part size (bp)
BBa_K608003 1/5A Promoter +RBS 56
BBa_K569017 1/8K CheY 390
BBa_K629003 1/18G CheZ 644
BBa_I759001 3/3J Rluc 936
BBa_B0017 3/6C Terminator 128 **
BBa_I15017 4/21N eYFP 717

* location name is as follows: plate number/well number (e.g. 1/5A means plate 1 well 5A)
** this part contains two copies of BBa_B0010 (64 bp each) but the exact size of the fragment is unspecified on the wiki page.

31/07/18

Transformation was successful, colonies were picked and inoculated in 5 ml LB containing the correct antibiotic.

01/08/18

Isolated the plasmids containing the biobricks from the inoculated colonies from 31/07/18 according to the plasmid purification protocol. (for concentrations see table below)

Concentration (ug/ml)
Biobrick Kit location* Part name Replicate 1 Replicate 2
BBa_K608003 1/5A Promoter +RBS 76,8 77,8
BBa_K569017 1/8K CheY 51 50,5
BBa_K629003 1/18G CheZ 83,1 111,9
BBa_I759001 3/3J Rluc 81,2 89,7
BBa_B0017 3/6C Terminator 137,8 75,4
BBa_I15017 4/21N eYFP 70 70,9

Performed a PCR, as described in the PCR protocol, to amplify the parts CheY, CheZ, Rluc, eYFP so that they can be used for Gibson assembly later in the project. The primers used are listed in the table below.

Part Primer name Primer sequence 5’--> 3’
CheZ CheZ_F1 gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
CheZ_R1 CCTTGGAAGCCATTCCACCTCCACCTCCAAATCCAAGACTATCCAACAAATCG
Rluc Rluc_F1 AGTCTTGGATTTGGAGGTGGAGGTGGAATGGCTTCCAAGGTGTACG     
Rluc_R1 tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag
eYFP YFP_F1      gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
YFP_R1      CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG    
CheY CheY_F1      CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG         
CheY_R1     tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

02/08/18

Performed a gel electrophoresis on the PCR product from 01/08/18 on a 1.5% agarose gel according to the gel electrophoresis protocol. The resulting bands were isolated according to the gel purification protocol.

PCR product Concentration (ug/ml)
CheY /
Rluc 45,6
CheZ 59,9
eYFP 26,6

A second PCR was performed to retrieve CheY. Also eYFP, LuxA, and LuxB were amplified with overhang extension PCR to add a gibson overhang to these parts. Used primers are listed in the table below.

Part Primer name Sequence 5’ -> 3’
LuxA M13 fwd tgtaaaacgacggccagt
LuxAB_Gibson_R1 gatttGGAGGTGGAGGTGGAATGAAGTTTGGAAACTTCCTG
LuxB LuxAB_Gibson_F1 gatttGGAGGTGGAGGTGGAATGAAGTTTGGAAACTTCCTG
T3 tccctttagtgagggttaat
eYFP YFP_F1 gccagtgaattgtaatacgactcactatagggcgaattgggaattcgcggccgcttctag
YFP_R1 CTTATCAGCCATTCCACCTCCACCTCCCTTGTACAGCTCGTCCATGCCG
CheY CheY_F1 CGAGCTGTACAAGGGAGGTGGAGGTGGAATGGCTGATAAGGAATTGAAG
CheY_R1 tcactaaagggaacaaaagctggagctccaccgcggtggcctgcagcggccgctactag

The PCR product was ran on a 1.5% agarose gel (figure 2)

03/08/18

LUXA and LuxB were isolated using PCR directly from the gBlock, since we expected the product of 02/08/18 to contain an error. The PCR product was ran on a 0.8% agarose gel and the correct bands were isolated according to the gel extraction protocol.

06/08/18

The CheZ and RLuc, and LuxA and LuxB fragments were fused together using Gibson assembly as described in the Gibson protocol. 9 µl of each Gibson product was transformed to 100 µl of DH5ɑ, since this increases the amount of successful transformations.

07/08/18

The transformations were successful. 2 colonies from each plate were picked and analysed for bands of a correct size through colony PCR as described in the colony PCR protocol. These bacteria were inoculated overnight at 37 °C in a rotary shaker.

08/08/18

DNA of inoculations (07/08/18) was purified according the miniprep protocol. The acquired DNA was sent for sequencing.

09/08/18

PCR was performed according to the protocol to create the correct overhangs for gibson assembly of CheY.

10/08/18

PCR product from 09/08/18 was ran on 0.8% gel and isolated the DNA using the Gel purification protocol

15/08/18

eYFP::CheY was assembled according to the Gibson cloning protocol. The cloning product was transformed into DH5α according to the iGEM transformation protocol.

16/08/18

Made a plate containing the positive colonies and inoculated them overnight.

Colony PCR of ((18/08/18 eYFP::CheY)(08/07/18 CheZ::Rluc)) was performed according to the protocol. Positive samples were selected and inoculated overnight.

17/08/18

eYFP::CheY DNA 16/08/18
Inoculation from colony Concentration (ng/µl)
1 224.5
2 277.5
3 334.4
4 280.4

20/08/18

The purified DNA samples (17/08/18) were sent for sequencing with m13 forward and reverse primer

27/08/18

were sent for sequencing with m13 forward and reverse primer

Reverse Primer CheY reverse CheY reverse Reverse 2 M13 reverse CheZ reverse, luxAB overhang eYFP reverse
DNA Forward Primer
1. CheY (kit) Long Forward
2. CheY (kit) Short forward
3. CheY (Gblock) GblockCheY forward
4. LuxAB LuxAB forward, CheZ overhang
5. CheZ (kit) CheZ forward 1
6. eYFP eYFP forward

The samples were ran on an 0.8% gel and bands were isolated

1 2 3 4 5 6
10 10.1 5.7 3.7 0.9 0

28/08/18

Repeat of 27/08/18, difference: PCR settings as KOD polymerase with 35 cycles. Ran the product on 0.8% (w/v) agarose gel and isolated it using the gel purification protocol.

The fragments were used to perform a Gibson assembly of eYFP::CheY, and 9 µl of the product was transformed to 100 µl DH5a.

29/08/18

We checked the plates from 28/09/18 but none of the transformations were successful.

03/09/18

We performed the gibson reaction of eYFP::CheY again. The gibson product was transformed directly to DH5a. Furthermore, a gibson overhang for the CheZ and LuxAB fragments was created by PCR with primers that were extended. The PCR products were ran on a 0.8% agarose gel. The gel revealed faint bands, but no ladder. Hence we didn’t proceed with these samples.

11/09/18

Since our the constructs used during our project needed a promoter in order to be expressed promoter BBa_K608003 was isolated from the DNA distribution kit (plate 1 well 5A). This DNA was transformed to DH5a.

12/09/18

Colonies from 11/09/18 were picked and inoculated overnight.

12/09/18

DNA from inoculations was isolated according to the miniprep protocol. The promoter part was was cloned in front of Both eYFP::CheY from 28/08/18, and CheZ::RLuc using the iGEM 3A assembly protocol. The samples were transformed to DH5a.

14/09/18

eYFP::CheY plates were observed under the fluorescence binoculars. 2 YFP colonies could be observed. These colonies were inoculated overnight at 37°C.

15/09/18

The inoculated bacteria were used for a miniprep and the DNA was send for sequencing.

06/10/18

Oligo annealing

Oligos containing the promoter CheZ::RLuc part sequence were annealed according to the annealing protocol

CheZ Rluc Digestion

Two CheZ::Rluc samples (CheZ::Rluc 440 ng/μl, CheZ::Rluc 430 ng/μl) were digested with Xbal and EcoR1 according to the iGEM restriction digest protocol.

Oligo CheZ::Rluc ligation

Protomoter Oligo was ligated into the Xbal Rluc digested CheZ::Rluc backbone according to the iGEM T4 ligase protocol . 1 μl of CheZ::Rluc backbone with 1 μl of oligo was used. Both 440 ng/μl and 430 ng/μl sample were ligated with the oligo.

Transformation

The new vector product (promoter::CheZ::Rluc) was transformed into DH5α according to the iGEM transformation protocol.

  • CheZ Rluc A
  • CheZ Rlux B

Anneal A = Oligo insert::CheZ::Rluc (originating from sample CheZ::Rluc 430 ng/μl )
Anneal B = Oligo insert::Chez::Rluc (originating from sample CheZ::Rluc 440 ng/μl )

07/10/18

Transformation was succesful

Three colonies were picked from transformation A and two colonies were picked from transformation B, both were inoculated in 5 ml LB containing ampicillin.

08/10/18

DNA was purified from the following samples using the miniprep protocol and sent for sequencing.

Sample Concentration ng/μl
CheZ Rluc A4 584.1
CheZ Rluc B4 549.6
CheZ Rluc A2 522.3
CheZ Rluc A1 463.8
CheZ Rluc B3 539.9

The Gibson cloning was transformed in DH5α according to the protocol.

09/10/18

Transformation was successful

Two colonies were picked and inoculated in 5 ml LB containing ampicillin.

10/10/18

DNA from the two inoculation of 1/5A::CheZ::Rluc after gibson cloning was retrieved with miniprep according to the protocol in the following concentrations.

Sample 1: 139.9 ng/μl
Sample 2: 75.5 ng/μl

11/10/18

In order to implement the complete BRET-pair and the mutated TAR-receptor, all three constructs needed to be in different vectors. Therefore, the CheZ Rluc and 1/5A::eYFP::Chey DNA was put in the iGEM pSB1K3 vector. Both samples including the vector were cut with EcoRI and PstI. Assembly of products was performed according to the iGEM 3A assembly protocol resulting in the following samples:

1/5A eYFP CheY in pSB1K3
1/5A CheZ Rluc in pSB1K3 (sample 1)
1/5A CheZ Rluc in pSB1K3 (sample 2)

These samples were transformed in combination with the mutated TAR receptor DNA. The following samples were transformed.

Sample Content Cell line
1 SDM Q491A DH5α
2 SDM E309A DH5α
3 [⅕A::eYFP::CheY] Kan U1250
[SDM Q491A] Chlo
[CheZ::Rluc] Amp
4 [CheZ::Rluc (sample 1)] Kan U1250
[SDM Q491A] Chlo
[⅕A::eYFP::CheY] Amp
5 [CheZ::Rluc (sample 2)] Kan U1250
[SDM Q491A] Chlo
[⅕::eYFP::CheY] Amp
6 [[⅕A::eYFP::CheY] Kan U1250
[SDM E309A] Chlo
[CheZ::Rluc] Amp
7 [CheZ::Rluc (sample 1)] Kan U1250
[SDM E309A] Chlo
[⅕A+eYFP+CheY] Amp
8 [CheZ::Rluc (sample 2)] Kan U1250
[SDM E309A] Chlo
[⅕A::eYFP::CheY] Amp
9 [⅕A::eYFP::CheY] Kan DH5α
10 [CheZ::Rluc (sample 1)] Kan DH5α
11 [CheZ::Rluc (sample 2)] Kan DH5α

12/10/18

SDM transformations (Lab Journal Methylation) and triple transformations were successful. When the plates were inspected under the fluorescence binoculars, several eYFP positive colonies could be identified that weren’t RFP positive. This indicated that these bacteria contained all 3 plasmids, and weren’t antibiotic resistant due to self ligation events of the linearized vector backbone used on 10/11/18.

2 colonies were picked and inoculated in 5 ml LB with ampicillin, kanamycin, chloramphenicol. The selection of colonies was based on increased YFP expression and low RFP expression (background plasmid signal).

The following samples were transformed

U1250
Sample Cell line
6/15B (TAR WT), U1250
FRET pair U1250
BRET pair (1/5A::CheZ::Rluc)(1/5A::eYFP::CheY) U1250
6/15B (TAR WT), FRET pair U1250
6/15B (TAR WT), BRET pair (1/5A::CheZ::Rluc)(1/5A::eYFP::CheY)
FRET pair, SDM E309A U1250
FRET pair, Q491A U1250

13/10/18

Inoculations were spun down, washed once with 1x PBS and resuspended in 1x PBS. 500 μg coerentazine was solubilized in ethanol to reach a final concentration of 7.5 mM. An aliquot was taken from this stock to make a 30x solution with 1x PBS. 480 μl bacteria were put in a 400 μl quartz cuvette and 20 μl 30x coerentazine solution was added. The solution was oxygenated using a pipette. No luminescence could be observed.

ksjdfljslfkdjlkghjfglhkjflhgkjflhgjflghjflghkjflhj
lskdfjslkjgdlkdfjgldkjlakmflsvmclkxmfklmgdmlkcvmblcmkb
Project Design
Results
Protocols