Team:SDSZ China/Experimental A

iGem SDSZ_China 2018

Obtaining Gene

Both fungal and bacterial acetylases have three functional domains- a deacetylase domain, a chitin binding zone, and a low density lipoprotein receptor region. By using the bioinformatics BLAST technique, a sequence highly conserved with known deacetylase domain sequences was searched in the NCBI soft armor gene database.

(1) chitin deacetylase 1 [Penaeus monodon] 1 atggcaagag taagatgcgg tagttctctt gccctccttg gcattgtgct gccgagcggg 61 tcaagaggca ggcagtttca gacacgaccg aggatggagc gaaccttcaa gagggaactg 121 tgcaaggata agggcgccgg cgagtggttc cgtctcagcc tcggtgactg tcgcgatgtg 181 atccagtgta ccgacgccgg tcttcaggcg ctgcgttgcc cccacggcct ggccttcaac 241 ctggagcagc agacctgcga ctggaaagcc aacgtcaaga actgcgacag gaaggagaag 301 acgaaggtcg tgaagcctct cttcaacacc gtcgagcccc tttgccagga aaaccagttg 361 gcgtgcggtg acggcacctg tctggatagg caggtcttct gtgatggaaa agaagattgt 421 accgatggtt ctgacgagac cgcatgtgac gtgaaaaatg accccaacag cgctcccatc 481 tgcaacaccg aggactgccg cctccccgat tgctactgct acaacgaccc tagcgagatg 541 ccccacaaca tgaagccttc cgaagtgcct cagatggtca ccatcacttt cgacgatgcc 601 atcaacatca acaacatgga cctgtacgag ctcatcttca agcagcgctt caaccccaac 661 ggctgctcca tcaagtccac cttcttcgtt tctcacaaat acaacaacta caccgccact 721 caggagatgc accgtctggg tcacgagatc gctgttcact ccatcaccca cgcaaacaac 781 gagactttct ggtcccacgc aagcgaagac gagtacgagc gcgaaatggg tggtgcccgc 841 gtcatcatcg aacgcttcgc caacatcacc gaccagtcca tcatcggcat gcgtaatccc 901 ttcctccgtg tgggcggcaa cagccagttc aggatgatgg agaagaacac cttcctgtac 961 gactccacca tcactgcccc cctgtcctcc atgcccctgt ggccctacac cctgtactac 1021 cgcatgcccc acccctgcca tggaaacctc cagaactgcc ccactcgctc cttcgcagtg 1081 tgggagatgg tcatgaacga gatggaccgt cgcgaggaac ccacttacga ggacggcctc 1141 cccggatgcc acatggtcga ttcctgcttc gccaccaagc ccgagcccga gcagttctac 1201 aacttcctgc agaacaactt caaccgccac tacaagtcaa accgcgctcc cttcggtctg 1261 ttcttccact ctgccttcct gaagaacaac cccgacatcc tggacacctt cctctactgg 1321 ctggacgaga ccctgaagaa ccagaaggac gtttacttcg tcaccatgac ccaggtcatc 1381 cagtggatgc aggacccccg ccccgtcggc cagctgaaca actacgaggc ctggaaggag 1441 aagtgcgtcg tcgacggccc acccttctgc tacggcggca acaactgcga gctggacact 1501 gacgagctcc ctggccagac cctccacctg tccacctgca tgcggtgccc caacaattat 1561 ccctggacaa gggacccatt gggcgaggga ttcttctaa (2) PREDICTED: uncharacterized protein LOC108681649 [Hyalella azteca] 1 atgctgatgc atgtagccat catgctcatg ctgctggatc agcacgctca aggttcagag 61 cggcaccccc ggcagagcag caacgccacc accacagagc agctctgcag aggccgcgac 121 tctgaggagt acttcagact ctctgccggc gacgactgca gagacgttgt tagatgtgac 181 cgcagtggac gctctggccc cagccgcctg gccgcagtgc ggtgccccaa cggcctcgcc 241 ttcgacgtcg acagacaagt ctgtgactgg aagaccaaag tccgcaactg cgacagactt 301 gagagaccgc ggaagattaa gccgctgctg gtgacggagg agccgctgtg ctcggggacg 361 gacctggcgt gcggcagcgg cgtgtgtgtc gccaaggagc tcttctgtga tggcaaacct 421 gactgtgatg acggttccga cgagaacacg tgtggtgtgg aagaagatcc aaaccgagcc 481 caggtgtgcg acaaaagtca atgcgttttg ccagaatgtt tctgttccgt ggacggcact 541 agaattcctg gtgatatcaa cccaaaacaa acaccgcaaa tgatcaccat cacattttca 601 ggagcaatca accttgataa tgtggatttg tacgatgaca tcttcaacgg ggaaagaaag 661 aatcccaacg gttgtcaagt gaaagcaacg ttcttcacgt cgcacaagta caccaattac 721 tccgcagttc aagaactaca caggaaaggc catgagatcg ctgtgttctc gatctcgaac 781 aaagaaagtc gagactattg gtcccatgga acatacgacg actggcttgc tgaaatggct 841 ggggccagac tcatcgtcga acgtttcgcc aatatcacag ataattccat cgtcgggtta 901 cgagcgccct acctcagggt tggaggaaac gctcagttcg acatgatgaa cgatcagttc 961 ttcttctacg acgcttcgat tacagcgcca ttggggaaac ttccgctatg gccgtacaca 1021 ttgtacttca ggatgcctca caaatgtcac gggaacggcc aaaattgtcc atcacgctcc 1081 caccccgtct gggaaatggt catgaacgaa atggacagaa gagacgaccc agagtttgac 1141 gaaggactat ctgggtgtca ttacgtcgac tcctgcacca acatccggac tccaaagcaa 1201 tttgcccatt tcctcgagca caacttcaga cgacactaca acacaaaccg tgcaccactc 1261 ggcttgcatt tccacgcttc ttggctaaaa ggaaacaaaa attttaaaaa ggaactcatc 1321 aatttcattc agtcaaaatc gggcaaccct gacgtgtatt tcgtgaccat gcttcaagtg 1381 attcaatgga tgcaagcacc gaccgaagtg gcaggacttc gcgatttccc agaatggaag 1441 gagaaatgcg acgtgcaagg tctgccattt tgctcattac caaacacttg cccggtgagg 1501 acacgagaga ttcctgacga gactttgagt ttgttcacct gcatggactg cccccgcaac 1561 tacccctggc tgctcgaccc taccggggat ggcgtggaaa ttatataa (3) PREDICTED: uncharacterized protein LOC108681651 [Hyalella azteca] 1 atgtctagat taagattcgt ccttgtgcta ttgttcgcag cagcggcagt cttagctgag 61 gagcgtgaga agcgacaggc agcggaggcc gaggcgacgg tagacgagga tgccgtggac 121 gctttcacca gggagctgtg cgccagcaag ggcgcgcagg agtacttcag actcagcacg 181 caggattgca gaaaagtcat ccagtgcaca gaagtcggtc tggagagtct agtgtgcccc 241 cctagtcttg cattcgacct ggaactgcaa gcatgcaact ggaaggaaga ggtgaagaat 301 tgtgccaaga ccaccaaaga caagaaagtc aggcctctca ctgccaccaa ggaccccttg 361 tgcgagggcg gtaagctggc atgtggagac ggtgtgtgta tagcgaaaga gttgttctgc 421 gacggcaagc ctgactgtgc cgataattca gatgagaact tttgcgacat caactcagat 481 ccaaacagag ctcctcaatg taacaaggcc gaatgccagc tgccgaactg cttctgcatt 541 aacaacccta atgagacccc caacaatatc gaccctaagg atgtaccaca gatgatcatg 601 atcactttcg atgacgctgt caacaacaac aacgttgatc tctacgacct catcttcagt 661 ggccgcgcaa atccaaatgg ctgtgacatc aaagccacat tcttcgtgtc gcataaatac 721 acgaattaca ccgcagtcag cgaactacac cgcaaaggac acgaaatcgc cgtccactcc 781 atcagtcaca acgattccgc taccttctgg acggaagcca ctgtccaaga ctggaccaac 841 gaaatggcgg gagctcgaca gattgtcaat catttcgcca acatcactga taccacagtc 901 gtgggcgtcc gcgctcctta ccttcgagtg ggaggaaaca accaattcct catgatggaa 961 gagcaaggtt tcctctacga ttccaccatt gttgctcctt tggctgatgt gccactttgg 1021 ccctatattt tgtactaccg tatgcctcat gagtgtcatg ggcacattca ggtttgccct 1081 actcgggcat acgctgtttg ggaaatggtc atgaacgaaa tggaccgtcg tgaagaccct 1141 cttcatgaag agcctcttcc tggttgcgct atggtggact cctgcttctc gaacaggccg 1201 acaggcgatc aattttataa tttcttgaac aacaacttca accgccacta caactccaac 1261 cgcgctccta tgggactctt tttccactct gctttcctca agaacaaccc tgagatcctg 1321 gatgccttta cgttctggct cgacgaaatt cttagcactc acaaggacgt ctacttcgta 1381 accatgactc aagctcttta ctggctccag gatattgttc caattagtca agttgctaac 1441 ttcgagccct ggaaggataa gtgtgcagtc caaggccctc catcgtgcca gaacggagga 1501 aataactgta aattggacac tgctgaactg cccggcgaaa ccgtacgcct gtctacctgc 1561 atgccttgcc ccagcaggta cccctggttg ttggacccca atggtgatgg actattctaa (4) Verm 1 atgctgaccg ttgatggagc agtgaacgac ctgaactatg aaacctacag cagcgtcttc 61 cgccccgatc gcaccaaccc caatggctgc cctatccgag gcaccttctt tgtctcccat 121 gagtacacca actaccagca gggggaggac ctctacagca gagggcacga gattgctgtt 181 ggctccgtca gccgccgtgc cggtctagag gatgaagggg aagagtcctg gactggagag 241 atggtgacaa tgcgagaaat tcttactaaa tttgctggag tgcgcactga ggatctgaag 301 ggacagcgag gacctcacct caagcctggc agggaggctc agtatgaggt gctcagtgcc 361 tatgggttca cttgggactc taccatcaac aaccctccca caaaacacct agtttggccc 421 tactccctgg aatgcaagat gccccatgag tgccgagctg gttcctgccc cacacgatcc 481 ttccccggag tgtgggagct gcctatgaac tcccacttca aggacaccag tttccaggga 541 ggcttttgcc cttacctgga ccagtgcaac ttcagctact ag

< img src="http://2018.igem.org/wiki/images/c/c5/T--SDSZ_China--14.jpeg">

Inserting Expression Vector

1.Choosing prokaryotic expression vector (pET-28a)

2. Designing primers and restriction sites Chitin deacetylase 1 p5 GGATCCATGGCAAGAGTAAGATGCGG Chitin deacetylase 1 p3 AAGCTTTTAGAATCCCTCGCCC LOC108681649 p5 GGATCCATGCTGATGCATGTAGCCATC LOC108681649 p3 AAGCTTTTATATAATTTCCACGCCATCC LOC 108681651 p5 GGATCCATGTCTAGATTAAGATTCGTCC LOC 108681651 p3 AAGCTTTTAGAATAGTCCATCACCATTGG Verm p5 CGCGGATCCATGCTGACCGTTGAT Verm p3 GATTCGTGGTAGCTGAAGTTGCACTGGTC ChinB p5 CTTCAGCTACACCACGAATCCGGGTGTTAGC ChinB p3 CCGGAATTCCTACTGGAGTTGCCAC The restriction enzyme cutting sites of our experiment are BamH I (198) and Hind III (173)

3. Transfection The plasmid was diluted 1000-fold and 10000-fold, and the competent bacteria BL-21 was added for 30 minutes in an ice bath. Then we heated the bacteria at 42 degrees for one minute, and ice-bathed for five more minutes. After that, we added 400 ml of LB without Kana antibiotic and shook the bacterial fluid. Finally, the bacteria were sprayed on a petri dish with kana antibiotics.

4. Bacterial Fluid PCR to filter positive clones. To insure the plasmids were successfully transfected, we conducted bacterial fluid PCR. Our groupmates take ten 1.5 ml EP tubes, add 200 μl of kana resistant medium separately, directly draw a single clone with a small pipette tip and push the TIP directly into an EP tube. We covered the EP tube and shake the bacteria at 37 degrees for 2-3 hours. Then 1μl of the bacterial solution was used as a template to identify the PCR positive clone. DNA gel electrophoresis was used to see if there was a target strip to judge.

...

Inducing Expression

.

Detecting Activity

.

References

Soma, Yuki, et al. "Metabolic flux redirection from a central metabolic pathway toward a synthetic pathway using a metabolic toggle switch." Metabolic engineering 23 (2014): 175-184.
Soma, Yuki, and Taizo Hanai. "Self-induced metabolic state switching by a tunable cell density sensor for microbial isopropanol production." Metabolic engineering 30 (2015): 7-15.
Lutz, Rolf, and Hermann Bujard. "Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements." Nucleic acids research 25.6 (1997): 1203-1210.

...
...