Team:Linkoping Sweden/Parts

LiU iGEM

Parts

All parts

Collection

This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.

Primers used for all our experiments can be found below.

  • Vector reverse (VR): attaccgcctttgagtgagc
    • (used for sequencing and colony screening)
  • Vector forward 2 (VF2): tgccacctgacgtctaagaa
    • (used for sequencing and colony screening)
  • Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
    • (used to amplify pSB4A5 from the distributed plates)
  • Backbone ENX forward (BENXF): tactagtagcggccgctg
    • (used to amplify pSB4A5 from the distributed plates)
  • Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
    • (used for the improvement)
  • Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
    • (used for the improvement)
  • Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga
    • (used for colony screening of the improvement)