Order reagents
Chemical synthesis of U24 genes and primers
Get the eGFP, IRES, and empty vector pENTR from our PI’s lab.
PCR-Add restriction sites to GFP sequence
Verification by electrophoresis (1% Gel)
The experiment failed.
The PCR product was not specific.
PCR-Add restriction sites to GFP sequence 2nd
Changed the PCR protocol to the 2-step version.
Verification by electrophoresis (1% Gel)
The experiment succeed.
Gel extraction
We use the GeneJET Gel Extraction Kit (Thermo Scientific™) to do extraction.
We got 5 samples whose concentration is around 150 ng/μl, marked as EcoR-GFP-Kpn Gel extraction product 1-5 , stored at -20℃.
Overlap PCR- Point mutant of U24 Step 1
Verification by electrophoresis (2% Gel)
The experiment failed.
Overlap PCR- Point mutant of U24 Step 1 2nd
We decrease the volume of template.
Verification by electrophoresis (2% Gel)
Sample between 53-60℃ had expected product.
Gel extraction
Products:
U24 mut_F M13R PCR Gel extraction product 1 55.6ng/μl 122bp
U24 mut_F M13R PCR Gel extraction product 2 172.2ng/μl
U24 mut_R M13F PCR Gel extraction product 1 52.3ng/μl 355bp
U24 mut_R M13F PCR Gel extraction product 2 96.6ng/μl
Overlap PCR- Point mutant of U24 Step 2
Gel extraction
Products:
U24 Point mutant of U24 Step 2 Gel extraction product 1 61.3ng/μl
U24 Point mutant of U24 Step 2 Gel extraction product 2 51.7ng/μl
U24 Point mutant of U24 Step 2 Gel extraction product 3 121.9ng/μl
U24 Point mutant of U24 Step 2 Gel extraction product 4 178.5ng/μl
Enzyme digestion
Gel extraction
pUC57 KpnⅠ HindⅢ Enzyme digested vector 1 5.8ng/μl
pUC57 KpnⅠ HindⅢ Enzyme digested vector 2 4.5ng/μl
KpnⅠ-Mut U24-HindⅢ Gel extraction product 1 40.5ng/μl
KpnⅠ-Mut U24-HindⅢ Gel extraction product 2 36.5ng/μl
Enzyme ligation
Ligation at 16 ℃ overnight.
Digestion of coGFP-T2A DNA from previous PCR experiment and pUC57-HA-U24
Digest for 1 hour, the plasmid backbones were run on 1% agarose gel and gel extraction was performed (gel extraction kit, Omega BioTek). Digested PCR product was desalted with gel extraction kit.
Ligated for 2h, and transformed E coli DH5alpha. Single colony was picked and plasmid was miniprepped for Sequencing.
Sub-cloning of GFP-U24 and GFP-U24 mutant
Sequencing-comfirmed plasmid from last step was used as template for PCR (adding NotI and AscI restriction site)
Primer pair:
NotI-GFP 5' aaGCGGCCGCatggagagcgacgagagc 3'
U24-AscI 5' GGCGCGCCtcatcgcctttgacgattcacatg 3'
Resulting products were gel purified.
Digestion
Digest for 1 hour, the plasmid backbones were run on 1% agarose gel and gel extraction was performed (gel extraction kit, Omega BioTek). Digested PCR product was desalted with gel extraction kit.
Ligation
Ligated for 2h, and transformed E coli DH5alpha. Single colony was picked and plasmid was miniprepped for Sequencing.
Sub-cloning of GFP-U24 and GFP-U24 mutant into pEF1a lentiviral packaging vector.
Sequencing-comfirmed plasmid (pUC57) was used as template for PCR (adding EcoRI and XbaI restriction site)
Primer pair:
EcoRI-GFP 5' gGAATTCGCCACCATGGAGAGCGAC 3'
U24-XbaI 5' GCTCTAGATCATCGCCTTTGACGATTCACATG 3'
Resulting products were gel purified.
Digestion
Digest for 1 hour, the plasmid backbones were run on 1% agarose gel and gel extraction was performed (gel extraction kit, Omega BioTek). Digested PCR product was desalted with gel extraction kit.
Ligation
Ligated for 2h, and transformed E coli DH5alpha. Single colony was picked and plasmid was miniprepped for Sequencing.
Sub-cloning of GFP-U24 and GFP-U24 mutant
We picked 3 clones for each vector and sequenced them.
Bacteria culture pEntr GFP-U24 2 and Bacteria culture pEntr GFP-U24 mut 2 have the right sequences and they were renamed as Bacteria
culture pEntr GFP-U24 and Bacteria culture pEntr GFP-U24 mut.
Plasmid extraction- Plasmid pEntr GFP-U24 and pEntr GFP-U24 mut
We use the TIANprep Mini Plasmid Kit (TIANGEN®) to do extraction.
Transformation-Plasmid pTet-on, pCAR-CD19, pMD2G, and pSpAX2
Add 2μl plasmid into 25 μl competent cells DH5α.
Keep the tube on ice for 30 minutes.
Water bath at 42℃ for 60 seconds.
Keep the tube on ice for 10 minutes.
Plate smearing.
Sequencing- Plasmid pTet-on, pCAR-CD19, pMD2G, and pSpAX2
The clones’ sequences are all correct.
LR Reaction
pEntr GFP-U24 50ng
pTet-on 75ng
LR enzyme 1μl
pEntr GFP-U24 Mut 50ng
pTet-on 75ng
LR enzyme 1μl
Reacted at room temperature for 2 hours.
Transformation-LR Reaction Product
Sequencing- LR Reaction Product, pHAGE Tet-on-GFP-U24, pHAGE Tet-on-GFP-U24 mut,
pEF1a-GFP-U24, pEF1a-GFP-U24 mut
Only pHAGE Tet-on-GFP-U24 has correct sequence.
LR Reaction 2nd
pEntr GFP-U24 Mut 1 50ng
Tet-on 75ng
LR enzyme 1μl
ddH20 up to 5μl
pEntr GFP-U24 Mut 1 50ng
Tet-on 75ng
LR enzyme 1μl
ddH20 up to 10μl
pEntr GFP-U24 Mut 2 50ng
Tet-on 75ng
LR enzyme 1ul
ddH20 up to 5ul
Sequencing- LR Reaction 2nd Product
pTETON GFP MUT U24 1-1 1-2 1-3
pTETON GFP MUT U24 2-1 2-2 2-3
pTETON GFP MUT U24 3
pTETON GFP MUT U24 4
pTETON GFP MUT U24 1-2 has correct sequence.
LR Reaction 3rd
pTet-on 1ul
pEntr-GFP-U24 1ul
LR enzyme 1ul
ddH2O 2ul
Sequencing-
pEF1α-GFP-HA-U24 MUT 1 has correct sequence.
pEF1α-GFP-HA-U24 2 has correct sequence.
Finally, we got these 6 plasmids:
pENTR-GFP-U24
pENTR-GFP-U24 mut
pTeton-GFP-U24
pTeton-GFP-U24 mut
pEF1α-GFP-HA-U24
pEF1α-GFP-HA-U24 mut
Endo-free Plasmid extraction
We use the E.Z.N.A.® Endo-Free Plasmid Mini Kit I to do extraction, and the endo-free plasmids would be used in cellular experiments.
Jurkat cell recovery
Keep cell heating in water bath, and add them into a new 15ml centrifuge tube.
Centrifuge it at 900rpm for 4min.
Throw away the supernatant.
Cells were then resuspended in 10ml culture medium (RPMI+10%FBS).
Add the liquid into the 10cm culture dish and shake well.
Put the cell into the incubator.
HEK-293T cell recovery
The same as Jurkat cell thawing, change the culture medium with DMEM+10%FBS.
Change the liquid medium
Both Jurkat and HEK-293T.
Observe the vegetal status of cell.
Jurkat cell passage
Collect the culture medium containing cell into a 15ml centrifuge tube.
Centrifuge it at 900rpm for 4min. Throw away the supernatant.
Cells were then resuspended in 1ml culture medium.
Seed the cell into 5 culture dishes (10 cm) and put them into the incubator.
HEK-293T cell passage
Throw away the culture medium and wash the dish with 1ml PBS.
Throw away PBS and then add 1ml TE into the dish.
Put it into the incubator to digestion for 3min. After the digestion is completed, add 2ml
culture medium to terminate the digestion.
Collect the liquid containing cell into a 15ml centrifuge tube. Centrifuge it at 900rpm for 4min.
Throw away the supernatant.
Cells were then resuspended in 1ml culture medium. S
eed the cell into 5 culture dishes (10 cm) and put them into the incubator.
Observe the vegetal status of cell.
Jurkat cell passage and cryopreservation
The protocol of Jurkat cell passage is the same as before.
After that, add 900μl cell suspension and 100μl DMSO into cell cryopreservation tube.
Put it into the cryopreservation box and then put it at -80 ℃ fridge.
HEK-293T cell passage and cryopreservation
The protocol of HEK-293T cell passage is the same as before.
After that, add 900μl cell suspension and 100μl DMSO into cell cryopreservation tube.
Put it into the cryopreservation box and then put it at -80 ℃ fridge.
Observe the vegetal status of cell.
Jurkat cell passage and cryopreservation
The protocol of Jurkat cell passage is the same as before. After that, add 900μl cell suspension and 100μl DMSO into cell
cryopreservation tube. Put it into the cryopreservation box and then put it at -80 ℃ fridge.
HEK-293T cell passage and cryopreservation
The protocol of HEK-293T cell passage is the same as before. After that, add 900μl cell suspension and 100μl DMSO into cell
cryopreservation tube. Put it into the cryopreservation box and then put it at -80 ℃ fridge. At the same time, seed cell into 2 6-
well plates at 2×105 cell/well.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 6-well plate with ptet-on-U24-GFP for 9 wells and with pEF1α-u24-GFP for 1 well by
Lipofectamine™ 3000 Transfection Reagent according to its protocol.
Optimal concentration of Dox
After transfection of 12h, change the culture medium. Add different concentration doxycycline (Dox) into the 6-well plates as below.
Take pictures after adding dox of 0h, 2h, 4h, 6h, 8h, 24h. And collect the cell pellet after adding dox of 24h. Add 90μl RIPA and
10μl protease inhibitor cocktail into the cell pellet for complete lysis of proteins and then add 25μl 5× loading buffer, boiling
water bath for 10min.
Jurkat cell passage and cryopreservation
The same as before.
Western blot
For SDS-PAGE electrophoresis, 20μl of each sample was loaded and resolved on 12% SDS-PAGE gel. Protein in the gel was transferred to PVDF membrane (0.2μm, Millipore). After blocking with 5X skimmed milk (in TBST), the PVDF membrane was cut according to the marker size. The upper part was probed with anti-beta-actin monoclonal antibody (Abmart) diluted 1X skimmed milk (in TBST) at a ratio of 1:2000. The lower half was probed with anti-HA monoclonal antibody (BioLegend) diluted in 1X skimmed milk (in TBST) at a ratio of 1:2000. The membrane was washed 4 times with TBST and incubated with HRP-conjugated goat-anti-mouse polyclonal antibody (Thermo Scientific) at 1:5000 diluted in 1X skim milk (in TBST). The membrane was washed 4 times with TBST. Finally, the membrane was incubated with ECL western blot substrate (Thermo scientific) and the light was detected using X-ray films (FUJIFILM). The resulting films were scanned and analyzed using ImageJ.
The samples are what we get from the optimal concentration of dox experiment. According to the result of western blot, we make a
curve about the optimal dox concentration.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into a 6-well plate at 2×105 cell/well.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 6-well plate with ptet-on-U24-GFP for 6 wells by Lipofectamine™ 3000 Transfection
Reagent according to its protocol.
u24 expression pattern
After transfection of 12h, change the culture medium. Add 100ng/ml Dox (according to the optimal concentration experiment result
before) into the 6-well plate. Take pictures and collect cell pellet after adding dox of 0h, 4h, 6h, 8h, 12h, 24h. Add 90μl RIPA and
10μl protease inhibitor cocktail into the cell pellet for complete lysis of proteins and then add 25μl 5× loading buffer, boiling
water bath for 10min.
Western blot
The same as before. The samples are what we get from the u24 expression pattern experiment.
Jurkat cell passage and cryopreservation
The same as before.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into a 6-well plate at 2×105 cell/well.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 6-well plate with pEF1α-U24-GFP for 6 wells by Lipofectamine™ 3000 Transfection Reagent
according to its protocol. After transfection of 12h, change the culture medium.
CHX protein synthesis
After changing the culture medium of 24h, add 100 ug/ml cycloheximide(CHX) into the 6-well plate. And collect the cell pellet after
adding CHX of 0h, 2h, 4h, 6h, 8h, 10h. Add 90μl RIPA and 10μl protease inhibitor cocktail into the cell pellet for complete lysis
of proteins and then add 25μl 5× loading buffer, boiling water bath for 10min.
Western blot
The same as before. The samples are what we get from CHX experiment.
Jurkat cell passage and cryopreservation
The same as before.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into two 24-well plates at 5×104 cell/well.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 24-well plate with pEF1α-U24-GFP for 9 wells, with pEF1α-U24-mutant-GFP for 9 wells
and 9 wells for control by Lipofectamine™ 3000 Transfection Reagent according to its protocol. After transfection of 12h, change the
culture medium.
Growth curve
Count the number of the cell after trypan blue staining (3 replicates) after changing the culture medium of 24h (see as the pictures
below) to see whether u24 protein affects the growth of cell.
Growth curve
Count the number of the cell after trypan blue staining (3 replicates) after changing the culture medium of 48h.
Jurkat cell passage and cryopreservation >
The same as before.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into a 6-well plate at 2×105 cell/well.
Growth curve
Count the number of the cell after trypan blue staining (3 replicates) after changing the culture medium of 72h. Collect the data
from 24h, 48h and 72h, and make a growth curve.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 6-well plate with corresponding plasmid for 6 wells by Lipofectamine™ 3000 Transfection
Reagent according to its protocol (see as the pictures below). After transfection of 12h, change the culture medium, and add 100ng/ml
Dox to 1 well.
Flow cytometry
Cells were harvested and placed into a 15 ml centrifuge tube and washed three times with 1 ml of ice-cold 1 × PBS containing 4%
bovine serum albumin (BSA) wash buffer. After wash, cells were resuspended in 0.2 ml of the ice-cold wash buffer and incubated with 1
μg of protein L (GenScript, 1mg/ml) at 4°C for 45 minutes. Cells were washed with 1 ml of the ice-cold wash buffer three times, and
then incubated (in the dark) with 10 μl of PE Streptavidin (BD Biosciences, 5 μg/ml) at 4°C for 10 minutes. Cells were washed with
1 ml of the ice-cold wash buffer three times, and then were resuspended in 0.5 ml of the ice-cold wash buffer. 1 × 104 cells were
analyzed.
Jurkat cell passage and cryopreservation
The same as before.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into 10cm culture dishes at 2×106 cell/dish, and seed cell into a 6-well plate.
Lentivirus production
Prepare the plasmid mix by aliquoting plasmids into a 1.5-ml tube. For a 10 cm dish preparation, use10μg of transfer vector, 3.75μg
of psPAX2, 1.25g of pMD2G, either with 5μg pCAR, 5μg ptet-on-u24-GFP, 5μg ptet-on-u24-mutant-GFP, 5μg pEF1α-u24-GFP or 5μg
pEF1α-u24-mutant-GFP. Add 300μl Opti-MEM into the tubes and mix well. Prepare another 1.5-ml tube, containing 1.5ml Opti-MEM and
100μg PEIMAX and mix well. Stand still for 5min and then 1:1 mix the liquid of tubes containing PEIMAX and plasmids. Stand still for
10min and then add 600μl to the cell in the 10cm dishes. Change the culture medium after 8h.
Observe the vegetal status of cell.
Collect the lentivirus
Harvest the supernatant containing virus and add 10ml fresh culture medium to the dishes after changing medium of 48h. The virus is
stored at 4℃.
Collect the lentivirus
Harvest the supernatant containing virus and add 10ml fresh culture medium to the dishes after changing medium of 72h. Clear the
supernatant of 48h and 72h by filtering through a 0.45μm filter. Store them at -80 ℃.
Lentivirus infection
Use the cleared supernatant we get to transfect the Jurkat cell. Collect the Jurkat cell into several 15ml centrifuge tube and
resuspend the cell by 500μl culture medium and 500ul cleared supernatant containing lentivirus. Centrifuge the cell at 1600rpm for
1h and then seed them into the 6-well plate. Change the culture medium after 12h.
Antibiotics screening
Add 500 μg/ml G418 and 100ng/ml dox to Tet-on-transfected cells, 0.25 μg/ml puromycin to CAR-transfected cells. Take pictures after
12h, 24h and 48h.
Jurkat cell passage and cryopreservation
The same as before.
HEK-293T cell passage and cryopreservation
The same as before. At the same time, seed cell into a 6-well plate at 2×105 cell/well.
Transient transfection of HEK-293T cell
Transient transfect the HEK-293T cell of the 6-well plate with corresponding plasmid for 6 wells by Lipofectamine™ 3000 Transfection
Reagent according to its protocol (see as the pictures below). After transfection of 12h, change the culture medium, and add 100ng/ml
Dox to 1 well.
Flow cytometry
The same as before. Repeat the experiment we did before.
Lentivirus infected Jurkat cell expansion
Seed the cell we used to antibiotics screening into 6cm dishes. And seed the cell that didn’t undergo antibiotics screening into
10cm dishes. Prepare for flow cytometry.
Observe the vegetal status of cell.
Flow cytometry
The same as before. Here the cell used to do this experiment is lentivirus infected Jurkat cell. We both analysis the expression
level of GFP and CAR/CD3 through different antibodies.
Lentivirus infected Jurkat cell expansion
The same as before.
Observe the vegetal status of cell.
Flow cytometry
The same as before. Here the cell used to do this experiment is lentivirus infected Jurkat cell. We both analysis the expression
level of GFP and CAR/CD3 through different antibodies.
