Difference between revisions of "Team:Linkoping Sweden/Parts"
| Line 35: | Line 35: | ||
</h3> | </h3> | ||
<h4> | <h4> | ||
| − | This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts | + | This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on <a target="_blank" style="color:blue" href="http://parts.igem.org/">parts.igem.org</a>.</h4> |
<ul> | <ul> | ||
<li><b>Composite parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671420">BBa_K2671420</a></li> | <li><b>Composite parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671420">BBa_K2671420</a></li> | ||
Revision as of 17:03, 19 September 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts:BBa_K2671337
- Improved parts:
- Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026
- Verified biobrick: BBa_I746909
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga