Difference between revisions of "Team:Imperial College/Experiments"
| Line 139: | Line 139: | ||
.tg .tg-0lax{text-align:left;vertical-align:top} | .tg .tg-0lax{text-align:left;vertical-align:top} | ||
.tg .tg-m9r4{background-color:#ffffc7;text-align:left;vertical-align:top} | .tg .tg-m9r4{background-color:#ffffc7;text-align:left;vertical-align:top} | ||
| + | .table{ | ||
| + | overflow:hidden; | ||
| + | } | ||
</style> | </style> | ||
Revision as of 04:57, 17 October 2018
Methods
Contents
- Assembling the Pixcell Constructs
- Characterizing Pixcell Constructs
- Electrochemistry of Redox Modulators
- Spatial Electronic Control of Gene Induction
- Creating the Sox Library
- Characterising the Sox Library
- Testing Phenazine Methosulfate
- Biocontainment- Gp2 Growth Inhibition
- Fabric Bioprinting - Melanin
Experiments
Assembling the Pixcell Constructs
This protocol describes how to create the Pixcell construct and Pixcell construct with a degradation tag using Golden Gate assembly. Creating each of the constructs takes approximately two days
| Part | Description |
|---|---|
| pBR322 | A medium copy vector encoding ampicillin resistance with a pMB1,origin of replication and a mcherry cassette with BsaI sites on either end. |
| SoxRS | The gene encoding the transcription factor Sox R and the bidirectional promoter pSoxS/pSoxR which it regulates |
| GFP | Superfolded GFP which is used as a reporter gene to be placed under the control of inducible side of the promoter, pSoxS |
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
| Name | Template | Direction | Function | Tm (°C) | Sequence |
|---|---|---|---|---|---|
| PPC1 | MG1655 Genome |
Forward | Amplification of SoxRS regulon |
67.1 | CTAGTGGGTCTCCCTCGAGAGAAAGACAAAGACCGG |
| PPC2 | MG1655 Genome |
Reverse | Amplification of SoxRS regulon |
64 | GTCGATGGTCTCCCATAAATCTGCCTCTTTTCAGTG |
| PPC3 | GFP Storage Vector |
Forward | Amplification of GFP | 65 | GTCGATGGTCTCGTATGCGTAAAGGCGAAGAA |
| PPC4 | GFP Storage Vector | Reverse | Amplification of GFP | 68 | CTAGTGGGTCTCGGGACAGTAGCGAAAAAACCCCG |
| PPC5 | PixCell Construct | Forward | Addition of a degradation tag to GFP in the PixCell Construct |
65 | GCAAACGACGAAACTACGCTTTAGTAATGATACTAGAGCGCAAAAAACCCC |
| PPC6 | PixCell Construct | Reverse | Addition of a degradation tag to GFP in the PixCell Construct |
65 | CTAAAGCGTAGTTTCGTCGTTTGCCTTATACAGCTCGTCCATACCGTGG |
- PCR Reactions
- GFP Amplification.
- Gel Electrophoresis
- Golden Gate Assembly
- Transformation
- Addition of the Degradation Tag
- Ligation
- Transformation
-
The PixCell construct with deg tag was transformed into DJ901 cells using the KCM heat shock protocol.
The PCR was carried out using the primers PPC1 and PPC2 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 59.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.
The PCR was carried out using the primers PPC3 and PPC4 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 61.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.
Both PCR product were run on a 1% agarose gel and extracted using the New England Biolabs gel extraction kit using the recommended protocol.
The two amplicons were cloned into the pBR322 vector by adding 75ng of pBR322 and 30.1ng of SoxRS regulon and 23.4ng of GFP amplicon to the golden gate assembly mix (NEB, E1600S). Following the NEB protocol the mixture was incubated at 37°C for 1 hr and at 55°C, 5 mins.
The PixCell construct was transformed into DJ901 and Turbo cells using the KCM heat shock protocol.
Turbo cells containing the PixCell construct were grown overnight and miniprepped following the NEB protocol in order to obtain template DNA for the following PCR reaction. The PCR was carried out using the primers PPC5 and PPC6 and Phusion polymerase (New England Biolabs) with 3% DMSO. Following a protocol of 30 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 3 minutes, and a final extension at 72 °C for 10 minutes. These primers produce complementary overhangs which when ligated together add a degradation tag we designed to the 3’ end of the coding region of GFP.
The ends of the PCR amplicon produced from the primers PPC5 and PPC6 were ligated using T4 DNA ligase (NEB) following the recommended NEB protocol.
Characterizing Pixcell Constructs
This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475. All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background. Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.
- Autoclaved LB media
- Autoclaved 10x concentated LB media
- 500 uM pyocyanin stock solution (from Sigma-Aldrich, CAS: No. 86-66-5)
- 1250 mM potassium ferricyanide stock solution (from Sigma-Aldrich, CAS: No. 13746-66-2)
- 500 mM ferrocyanide stock solution (from Sigma-Aldrich, CAS 14459-95-1 )
- 2% Sodium Sulfite Solution
- Agar plates with colonies of E. coli DJ901 strains with respective constructs: PixCell Patterning Circuit 1 (BBa_K2862021). PixCell Patterning Circuit 2 (BBa_K2862022), negative control (DJ901 WT) and positive control (constitutively expressed GFP).
- 37°C shaking incubator
- BMG Labtech FLUOstar plate reader
- 4x Greiner BioOne 96-F 96-well microplate (black with clear bottom)
- 14 mL culture tubes
- autoclaved eppendorfs
Work in very sterile conditions. To prevent contaminations in the blanks, use triple antibiotics. Store pyocyanin and ferrocyanide and ferricyanide solutions in the freezer until use. We used 10x concentrated LB in order not to dilute nutrients at higher pyocyanin concentration; this was back diluted with autoclaved water. Mastemixes have double the working concentrations, as 100 uL of solution is then diluted with 100 uL of liquid cultures.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
- Grow starter liquid cultures of cells (Day 0, 10-15 min preparation + overnight)
- Prepare mastermixes (30 min)
- Fill 96-well plate with media solutions
- OD600 matching
- Add cells to 96-well plate
- Set up the script in the plate reader and start experiment
- Data analysis
Working in very sterile conditions, take 5 14mL culture tubes and prepare them according to table below:
| Label | E. coli strain | Construct | Antibiotic (Ab) | V Ab (uL) | V LB (mL) |
|---|---|---|---|---|---|
| PC1 | DJ901 | BBa_K2862021 | Kan + Amp | 5 + 5 | 5 |
| PC2 | DJ901 | BBa_K2862022 | Kan + Amp | 5 + 5 | 5 |
| - | DJ901 | none | Kan | 5 | 5 |
| + | DJ901 | GFP_Boo | Kan + Chl | 5 + 5 | 5 |
| Blanks | None | None | Kan + Amp + Chl | 5 + 5 | 5 |
With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator). We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)
Mastermixes for each redox molecule concentration prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.
Mastermizes for Day 1 and Day 2 :
| Condition | V Pyo (uL) | Kan (uL) | LB 10x uL | Autoclaved Water (uL) | Tot Vol (uL) |
|---|---|---|---|---|---|
| A = 0 uM Pyo | 0 | 2.44 | 122 | 1098 | 1220 |
| B = 0.01 uM Pyo | 0.0976 | 2.44 | 122 | 1097.9024 | 1220 |
| C = 0.025 uM Pyo | 0.244 | 2.44 | 122 | 1097.756 | 1220 |
| D = 0.05 uM Pyo | 0.488 | 2.44 | 122 | 1097.512 | 1220 |
| E = 0.1 uM Pyo | 0.976 | 2.44 | 122 | 1097.024 | 1220 |
| F = 0.25 uM Pyo | 2.44 | 2.44 | 122 | 1095.56 | 1220 |
| G = 0.5 uM Pyo | 4.88 | 2.44 | 122 | 1093.12 | 1220 |
| H = 1 uM Pyo | 9.76 | 2.44 | 122 | 1088.24 | 1220 |
Mastermixes for Day 3 and Day 4:
| Condition | V Pyo (uL) | Kan (uL) | LB 10x uL | Autoclaved Water (uL) | Tot Vol (uL) |
|---|---|---|---|---|---|
| A = 2.5 uM Pyo | 24.4 | 2.44 | 122 | 1073.6 | 1220 |
| B = 5 uM Pyo | 48.8 | 2.44 | 122 | 1049.2 | 1220 |
| C = 10 uM Pyo | 97.6 | 2.44 | 122 | 1000.4 | 1220 |
| D = 25 uM Pyo | 244 | 2.44 | 122 | 854 | 1220 |
| E = 50 uM Pyo | 488 | 2.44 | 122 | 610 | 1220 |
| F = 100 uM Pyo | 976 | 2.44 | 122 | 122 | 1220 |
We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:
| Condition | Volume of A-H Mastermix (uL) | Ampicillin (uL) | Chloramphenicol (uL) |
|---|---|---|---|
| PC1 + PC2 | 406 | 2.44 | 0 |
| + | 203 | 0 | 2.44 |
| - | 203 | 0 | 0 |
| Blanks | 406 | 2.44 | 2.44 |
Add 100 uL of media in the desired wells, according following the label on mastermixes and table below:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | PC1 | PC1 | BA | PC2 | PC2 | BA | - | - | BA | + | + | BA |
| B | PC1 | PC1 | BB | PC2 | PC2 | BB | - | - | BB | + | + | BB |
| C | PC1 | PC1 | BC | PC2 | PC2 | BC | - | - | BC | + | + | BC |
| D | PC1 | PC1 | BD | PC2 | PC2 | BD | - | - | BD | + | + | BD |
| E | PC1 | PC1 | BE | PC2 | PC2 | BE | - | - | BE | + | + | BE |
| F | PC1 | PC1 | BF | PC2 | PC2 | BF | - | - | BF | + | + | BF |
| G | PC1 | PC1 | BG | PC2 | PC2 | BG | - | - | BG | + | + | BG |
| H | PC1 | PC1 | BH | PC2 | PC2 | BH | - | - | BH | + | + | BH |
After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL
Cell dilution calculator: Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells E.g. to dilute 5mL of cells at an OD600 of 0.3 to OD of 0.1 = [ (5mL*0.3)/0.1 - 5] =10 mL
We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.
For Pyocyanin experiments:
We set up a script on the BMG Labtech Omega control software to perform endpoint absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200.
We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments
Electrochemistry of Redox Modulators
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Spatial Electronic Control of Gene Induction
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Creating the Sox Library
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
| Part | Promoter (for all 8 pSoxS) | Transcription factor (for all 6 SoxR) | Plasmid (p15A) | Constitutive promoter (Pfam2-J23101) | GFP |
| Linker prefix | LMP | UTR2-3 | LMS | L5 | UTR1-3 |
| Linker suffix | UTR1-3 | LMS | LMP | UTR2-3 | L5 |
| Construct name | Promoter (pSoxS) | Transcription factor (SoxR) | Plasmid | Constitutive promoter | GFP |
|---|---|---|---|---|---|
| PC_A1 | BBa_K2862006 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_A2 | BBa_K2862006 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_A3 | BBa_K2862006 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_A4 | BBa_K2862006 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_A5 | BBa_K2862006 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_A6 | BBa_K2862006 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_B1 | BBa_K2862007 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_B2 | BBa_K2862007 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_B3 | BBa_K2862007 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_B4 | BBa_K2862007 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_B5 | BBa_K2862007 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_B6 | BBa_K2862007 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_C1 | BBa_K2862008 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_C2 | BBa_K2862008 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_C3 | BBa_K2862008 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_C4 | BBa_K2862008 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_C5 | BBa_K2862008 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_C6 | BBa_K2862008 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_D1 | BBa_K2862009 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_D2 | BBa_K2862009 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_D3 | BBa_K2862009 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_D4 | BBa_K2862009 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_D5 | BBa_K2862009 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_D6 | BBa_K2862009 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_E1 | BBa_K2862010 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_E2 | BBa_K2862010 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_E3 | BBa_K2862010 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_E4 | BBa_K2862010 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_E5 | BBa_K2862010 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_E6 | BBa_K2862010 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_F1 | BBa_K2862011 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_F2 | BBa_K2862011 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_F3 | BBa_K2862011 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_F4 | BBa_K2862011 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_F5 | BBa_K2862011 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_F6 | BBa_K2862011 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_G1 | BBa_K2862012 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_G2 | BBa_K2862012 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_G3 | BBa_K2862012 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_G4 | BBa_K2862012 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_G5 | BBa_K2862012 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_G6 | BBa_K2862012 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
| PC_H1 | BBa_K2862013 | BBa_K2862014 | P15A-Amp | BBa_K2862019 | Yes |
| PC_H2 | BBa_K2862013 | BBa_K2862015 | P15A-Amp | BBa_K2862019 | Yes |
| PC_H3 | BBa_K2862013 | BBa_K2862016 | P15A-Amp | BBa_K2862019 | Yes |
| PC_H4 | BBa_K2862013 | BBa_K2862017 | P15A-Amp | BBa_K2862019 | Yes |
| PC_H5 | BBa_K2862013 | BBa_K2862018 | P15A-Amp | BBa_K2862019 | Yes |
| PC_H6 | BBa_K2862013 | SoxR-8 (not submitted)* | P15A-Amp | BBa_K2862019 | Yes |
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Characterising the Sox Library
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Testing Phenazine Methosulfate
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Biocontainment- Gp2 Growth Inhibition
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Fabric Bioprinting - Melanin
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
