Difference between revisions of "Team:Linkoping Sweden/Parts"
| (8 intermediate revisions by 3 users not shown) | |||
| Line 11: | Line 11: | ||
<body> | <body> | ||
<header> | <header> | ||
| − | <img src="https://static.igem.org/mediawiki/2018/ | + | <a href="https://2018.igem.org/Team:Linkoping_Sweden"> |
| + | <img src="https://static.igem.org/mediawiki/2018/a/af/T--Linkoping_Sweden--helvitlogo.png" alt="iGEM-logo" class="logo" </a> | ||
<nav> | <nav> | ||
<ul class="liu-menu"> | <ul class="liu-menu"> | ||
| − | <li><a | + | <li><a href="/Team:Linkoping_Sweden">Home</a></li> |
| − | <li><a class="dropbutton" | + | <li class="dropdown"> |
| − | <li | + | <a href="/Team:Linkoping_Sweden/Human_Practices" class="dropbutton">Human Practices</a> |
| − | <li><a class="dropbutton" | + | <div class="dropdown-content"> |
| − | <li><a class="dropbutton" | + | <a href="/Team:Linkoping_Sweden/Public_Engagement">Public Engagement</a> |
| − | <li><a class="dropbutton" | + | </div></li> |
| + | <li class="dropdown"> | ||
| + | <a href="/Team:Linkoping_Sweden/Collaborations" class="dropbutton">Collaborations</a></li> | ||
| + | <li class="dropdown"> | ||
| + | <a href="/Team:Linkoping_Sweden/Team" class="dropbutton">Team</a> | ||
| + | <div class="dropdown-content"> | ||
| + | <a href="/Team:Linkoping_Sweden/Contact">Contact</a> | ||
| + | </div> | ||
| + | </li> | ||
| + | <li class="dropdown"> | ||
| + | <a href="/Team:Linkoping_Sweden/Project" class="dropbutton">Project</a> | ||
| + | <div class="dropdown-content"> | ||
| + | <a href="/Team:Linkoping_Sweden/Model">Model</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Notebook">Notebook</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Design">Design</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Experiments">Experiments</a> | ||
| + | |||
| + | <a href="/Team:Linkoping_Sweden/Parts">Parts</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Safety">Safety</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Demonstrate">Demonstrate</a> | ||
| + | <a href="/Team:Linkoping_Sweden/Improve">Improve</a> | ||
| + | </div></li> | ||
| + | <li class="dropdown"> | ||
| + | <a href="/Team:Linkoping_Sweden/Attributions" class="dropbutton">Attributions</a> | ||
| + | <div class="dropdown-content"> | ||
| + | <a href="/Team:Linkoping_Sweden/Sponsors">Sponsors</a> | ||
| + | </div></li> | ||
</ul> | </ul> | ||
</nav> | </nav> | ||
</header> | </header> | ||
| − | <section class=" | + | <section class="superproject"> |
<h1>Parts</h1> | <h1>Parts</h1> | ||
</section> | </section> | ||
| Line 40: | Line 67: | ||
<li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671337">BBa_K2671337</a> </li> | <li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671337">BBa_K2671337</a> </li> | ||
<li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | <li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | ||
| − | <li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" | + | <li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602021">BBa_K2602021</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602024">BBa_K2602024</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602026">BBa_K2602026</a></li> |
<li><b>Verified biobrick:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_I746909">BBa_I746909</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K173007">BBa_K173007</a> | <li><b>Verified biobrick:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_I746909">BBa_I746909</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K173007">BBa_K173007</a> | ||
| Line 49: | Line 76: | ||
Primers used for all our experiments can be found below.</h4> | Primers used for all our experiments can be found below.</h4> | ||
<ul> | <ul> | ||
| − | <li><b>Vector reverse (VR):</b> attaccgcctttgagtgagc </li> | + | <li><b>Vector reverse (VR):</b> attaccgcctttgagtgagc </li> (used for sequencing and colony screening) |
| − | <li><b>Vector forward 2 (VF2):</b> tgccacctgacgtctaagaa </li> | + | <li><b>Vector forward 2 (VF2):</b> tgccacctgacgtctaagaa </li> (used for sequencing and colony screening) |
| − | <li><b>Backbone SNP reverse (BSNPR):</b> ctctagaagcggccgcgaat </li> | + | <li><b>Backbone SNP reverse (BSNPR):</b> ctctagaagcggccgcgaat </li> (used to amplify pSB4A5 from the distributed plates) |
| − | <li><b>Backbone ENX forward (BENXF):</b> tactagtagcggccgctg </li> | + | <li><b>Backbone ENX forward (BENXF):</b> tactagtagcggccgctg </li> (used to amplify pSB4A5 from the distributed plates) |
| − | <li><b>Liu iGEM17 site directed mutagenesis reverse (SDMR):</b> cccgaaccgctttacttg </li> | + | <li><b>Liu iGEM17 site directed mutagenesis reverse (SDMR):</b> cccgaaccgctttacttg </li> (used for the improvement) |
| − | <li><b>Liu iGEM17 site directed mutagenesis forward (SDMR):</b> ctcaggaagcactagtggctcggac </li> | + | <li><b>Liu iGEM17 site directed mutagenesis forward (SDMR):</b> ctcaggaagcactagtggctcggac </li> (used for the improvement) |
| − | <li><b>Liu iGEM17 mNG forward (mNG-F):</b> ggactggtgcaggtcgaaga</li> | + | <li><b>Liu iGEM17 mNG forward (mNG-F):</b> ggactggtgcaggtcgaaga</li> (used for colony screening of the improvement) |
</ul> | </ul> | ||
</div> | </div> | ||
Latest revision as of 16:21, 17 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc (used for sequencing and colony screening)
- Vector forward 2 (VF2): tgccacctgacgtctaagaa (used for sequencing and colony screening)
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat (used to amplify pSB4A5 from the distributed plates)
- Backbone ENX forward (BENXF): tactagtagcggccgctg (used to amplify pSB4A5 from the distributed plates)
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg (used for the improvement)
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac (used for the improvement)
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga (used for colony screening of the improvement)