Difference between revisions of "Team:Linkoping Sweden/Parts"
| (2 intermediate revisions by 2 users not shown) | |||
| Line 18: | Line 18: | ||
<li class="dropdown"> | <li class="dropdown"> | ||
<a href="/Team:Linkoping_Sweden/Human_Practices" class="dropbutton">Human Practices</a> | <a href="/Team:Linkoping_Sweden/Human_Practices" class="dropbutton">Human Practices</a> | ||
| − | + | <div class="dropdown-content"> | |
| − | + | <a href="/Team:Linkoping_Sweden/Public_Engagement">Public Engagement</a> | |
| + | </div></li> | ||
<li class="dropdown"> | <li class="dropdown"> | ||
<a href="/Team:Linkoping_Sweden/Collaborations" class="dropbutton">Collaborations</a></li> | <a href="/Team:Linkoping_Sweden/Collaborations" class="dropbutton">Collaborations</a></li> | ||
| Line 66: | Line 67: | ||
<li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671337">BBa_K2671337</a> </li> | <li><b>Basic Parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671337">BBa_K2671337</a> </li> | ||
<li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | <li><b>Improved parts:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2671000">BBa_K2671000</a> </li> | ||
| − | <li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" | + | <li><b>Verified collaboration parts:</b> <a target="_blank" style="color:blue" <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602021">BBa_K2602021</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602024">BBa_K2602024</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K2602026">BBa_K2602026</a></li> |
<li><b>Verified biobrick:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_I746909">BBa_I746909</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K173007">BBa_K173007</a> | <li><b>Verified biobrick:</b> <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_I746909">BBa_I746909</a>, <a target="_blank" style="color:blue" href="http://parts.igem.org/Part:BBa_K173007">BBa_K173007</a> | ||
Latest revision as of 16:21, 17 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc (used for sequencing and colony screening)
- Vector forward 2 (VF2): tgccacctgacgtctaagaa (used for sequencing and colony screening)
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat (used to amplify pSB4A5 from the distributed plates)
- Backbone ENX forward (BENXF): tactagtagcggccgctg (used to amplify pSB4A5 from the distributed plates)
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg (used for the improvement)
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac (used for the improvement)
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga (used for colony screening of the improvement)