Difference between revisions of "Team:Imperial College/Experiments"

Line 865: Line 865:
 
                 <div type="button" class="accordion"> Description </div>
 
                 <div type="button" class="accordion"> Description </div>
 
                 <div class="description">
 
                 <div class="description">
−
                    <p>
+
              <p> This protocol describes how to create a library of constructs varying two parts using BASIC assembly method. Following it we constructed a 48 constructs library, using 3 repeated parts and a variable promoter (pSoxS) with 8 variants, and a variable transcription factor (SoxR) with 6 variants (one of them unsubmitted to registry). </p>
−
All the experiments for this part of the project were performed on E. coli DH5α, origin strain for DJ901, as this last one could not be made super-competent (109 cfu / μg pUC19  DNA) enough to transform BASIC assembly products. Individual parts were integrated in chloramphenicol resistant high copy plasmid pSB1C3_BASIC vectors and assemblies were performed in ampicillin resistant mid copy plasmid p15A vectors. All individual parts were synthesised and ordered as gblocks with BASIC prefix and suffix through IDT. The linkers used were provided by Biolegio and the adaptors were courtesy of Dr. Baldwin’s lab at Imperial College London.  
+
−
 
+
−
</p>
+
 
                 </div>
 
                 </div>
  
 
                 <div type="button" class="accordion">Notes</div>
 
                 <div type="button" class="accordion">Notes</div>
 
                 <div class="panel expt5p">
 
                 <div class="panel expt5p">
 +
 +
    <p>
 +
All the experiments for this part of the project were performed on E. coli DH5α, origin strain for DJ901, as this last one could not be made super-competent (109 cfu / μg pUC19  DNA) enough to transform BASIC assembly products. Individual parts were integrated in chloramphenicol resistant high copy plasmid pSB1C3_BASIC vectors and assemblies were performed in ampicillin resistant mid copy plasmid p15A vectors. All individual parts were synthesised and ordered as gblocks with BASIC prefix and suffix through IDT. The linkers used were provided by Biolegio and the adaptors were courtesy of Dr. Baldwin’s lab at Imperial College London.
 +
 +
</p>
 +
 
<style type="text/css">
 
<style type="text/css">
 
.tg  {border-collapse:collapse;border-spacing:0;}
 
.tg  {border-collapse:collapse;border-spacing:0;}
Line 1,308: Line 1,311:
 
   </tr>
 
   </tr>
 
</table>
 
</table>
−
                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
+
 
−
                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+
<div class="caption">
−
                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>                
+
            <p><b>Figure 1.</b> Table indicating the composition of each construct</p>
−
                </div>
+
   
−
           
+
 
                      
 
                      
 
                 <div type="button" class="accordion" >Procedure</div>
 
                 <div type="button" class="accordion" >Procedure</div>
 
                 <div class="panel expt5p">
 
                 <div class="panel expt5p">
−
                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+
                     <p>Parts assembly for library generation was performed as described in Storch, Casini et al.,
 +
2015. Briefly, linkers were prepared adding 49 µl of annealing buffer (
 +
10mM TRIS-HCl buffer pH7.9, 100mM NaCl, 10mM MgCl2 ) to 0.5 µl (1 µM) of linker and
 +
0.5 µl (1 µM) of adapter oligos, and incubating at 95ºC for 1 min. Once linkers were ready
 +
they were mixed with the parts for the digestion/ligation reaction and incubated at 37ºC for
 +
1 hour, 20ºC for 20 min, 65ºC for 20 min. Each 30 µl reaction had 3µl of ATP, 3µl of NEB4,
 +
3µl BSA, 5µl of prefix linker (1µM), 5µl of suffix linker (1 µM), 1µl of BsaI (20 U/µl), 0.5 µl of
 +
T4 ligase (400 U/µl), 1µl DNA part (200 ng/µl) and water. Parts and linkers
 +
were mixed according to the following table.</p>
 
                 </div>
 
                 </div>
 
                 <div class="clr"></div>
 
                 <div class="clr"></div>

Revision as of 18:30, 17 October 2018


Methods



Contents

Experiments

Assembling the Pixcell Constructs

Access All

Description

This protocol describes how to create the Pixcell construct and Pixcell construct with a degradation tag using Golden Gate assembly. Creating each of the constructs takes approximately two days

Materials

  • pBR322
  • E.coli MG1655 genomic DNA
  • GFP Storage Vector
  • 10µM of Primers
  • Q5 polymerase (New England Biolabs, #M0491)
  • 1% Agarose Gel
  • TAE Buffer
  • Monarch® DNA Gel Extraction Kit (NEB, #T1020S)
  • Golden Gate Assembly Mix (NEB, E1600S)
  • DJ901 and Turbo Cells
  • KCM
  • Phusion polymerase (NEB, #M0530S)
  • T4 DNA ligase (NEB, #M0202)

    • Notes
    Part Description
    pBR322 A medium copy vector encoding ampicillin resistance with a pMB1,origin of replication and a mcherry cassette with BsaI sites on either end.
    SoxRS The gene encoding the transcription factor Sox R and the bidirectional promoter pSoxS/pSoxR which it regulates
    GFP Superfolded GFP which is used as a reporter gene to be placed under the control of inducible side of the promoter, pSoxS

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Name Template Direction Function Tm (°C) Sequence
    PPC1 MG1655
    Genome
    		 Forward Amplification of SoxRS
    regulon    		 67.1 CTAGTGGGTCTCCCTCGAGAGAAAGACAAAGACCGG
    PPC2 MG1655
    Genome
    		 Reverse Amplification of SoxRS
    regulon    		 64 GTCGATGGTCTCCCATAAATCTGCCTCTTTTCAGTG
    PPC3 GFP Storage
    Vector    		 Forward Amplification of GFP 65 GTCGATGGTCTCGTATGCGTAAAGGCGAAGAA
    PPC4 GFP Storage Vector Reverse Amplification of GFP 68 CTAGTGGGTCTCGGGACAGTAGCGAAAAAACCCCG
    PPC5 PixCell Construct Forward Addition of a degradation
    tag to GFP in the PixCell Construct    		 65 GCAAACGACGAAACTACGCTTTAGTAATGATACTAGAGCGCAAAAAACCCC
    PPC6 PixCell Construct Reverse Addition of a degradation
    tag to GFP in the PixCell Construct    		 65 CTAAAGCGTAGTTTCGTCGTTTGCCTTATACAGCTCGTCCATACCGTGG
    1. PCR Reactions
      2. SoxRS regulon Amplification

      The PCR was carried out using the primers PPC1 and PPC2 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 59.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

    2. GFP Amplification.

      3. The PCR was carried out using the primers PPC3 and PPC4 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 61.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

    3. Gel Electrophoresis

      4. Both PCR product were run on a 1% agarose gel and extracted using the New England Biolabs gel extraction kit using the recommended protocol.

    4. Golden Gate Assembly

      5. The two amplicons were cloned into the pBR322 vector by adding 75ng of pBR322 and 30.1ng of SoxRS regulon and 23.4ng of GFP amplicon to the golden gate assembly mix (NEB, E1600S). Following the NEB protocol the mixture was incubated at 37°C for 1 hr and at 55°C, 5 mins.

    5. Transformation

      6. The PixCell construct was transformed into DJ901 and Turbo cells using the KCM heat shock protocol.

    6. Addition of the Degradation Tag

      7. Turbo cells containing the PixCell construct were grown overnight and miniprepped following the NEB protocol in order to obtain template DNA for the following PCR reaction. The PCR was carried out using the primers PPC5 and PPC6 and Phusion polymerase (New England Biolabs) with 3% DMSO. Following a protocol of 30 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 3 minutes, and a final extension at 72 °C for 10 minutes. These primers produce complementary overhangs which when ligated together add a degradation tag we designed to the 3’ end of the coding region of GFP.

    7. Ligation

      8. The ends of the PCR amplicon produced from the primers PPC5 and PPC6 were ligated using T4 DNA ligase (NEB) following the recommended NEB protocol.

    8. Transformation

    9. The PixCell construct with deg tag was transformed into DJ901 cells using the KCM heat shock protocol.

    Characterizing Pixcell Constructs

    Access All

    Description

    This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475. All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background. Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.

    Materials
    • Autoclaved LB media
    • Autoclaved 10x concentated LB media
    • 500 uM pyocyanin stock solution (from Sigma-Aldrich, CAS: No. 86-66-5)
    • 1250 mM potassium ferricyanide stock solution (from Sigma-Aldrich, CAS: No. 13746-66-2)
    • 500 mM ferrocyanide stock solution (from Sigma-Aldrich, CAS 14459-95-1 )
    • 2% Sodium Sulfite Solution
    • Agar plates with colonies of E. coli DJ901 strains with respective constructs: PixCell Patterning Circuit 1 (BBa_K2862021). PixCell Patterning Circuit 2 (BBa_K2862022), negative control (DJ901 WT) and positive control (constitutively expressed GFP).
    • 37°C shaking incubator
    • BMG Labtech FLUOstar plate reader
    • 4x Greiner BioOne 96-F 96-well microplate (black with clear bottom)
    • 14 mL culture tubes
    • autoclaved eppendorfs
    Notes

    Work in very sterile conditions. To prevent contaminations in the blanks, use triple antibiotics.
    Store pyocyanin and ferrocyanide and ferricyanide solutions in the freezer until use.
    We used 10x concentrated LB in order not to dilute nutrients at higher pyocyanin concentration; this was back diluted with autoclaved water. Mastemixes have double the working concentrations, as 100 uL of solution is then diluted with 100 uL of liquid cultures.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    1. Grow starter liquid cultures of cells (Day 0, 10-15 min preparation + overnight)

      2. Working in very sterile conditions, take 5 14mL culture tubes and prepare them according to table below:

      Label E. coli strain Construct Antibiotic (Ab) V Ab (uL) V LB (mL)
      PC1 DJ901 BBa_K2862021 Kan + Amp 5 + 5 5
      PC2 DJ901 BBa_K2862022 Kan + Amp 5 + 5 5
      - DJ901 none Kan 5 5
      + DJ901 GFP_Boo Kan + Chl 5 + 5 5
      Blanks None None Kan + Amp + Chl 5 + 5 5

      With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator). We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)

    2. Prepare mastermixes (30 min)

      3. Mastermixes for each redox molecule concentration prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.

      Mastermizes for Day 1 and Day 2 :

      Condition V Pyo (uL) Kan (uL) LB 10x uL Autoclaved Water (uL) Tot Vol (uL)
      A = 0 uM Pyo 0 2.44 122 1098 1220
      B = 0.01 uM Pyo 0.0976 2.44 122 1097.9024 1220
      C = 0.025 uM Pyo 0.244 2.44 122 1097.756 1220
      D = 0.05 uM Pyo 0.488 2.44 122 1097.512 1220
      E = 0.1 uM Pyo 0.976 2.44 122 1097.024 1220
      F = 0.25 uM Pyo 2.44 2.44 122 1095.56 1220
      G = 0.5 uM Pyo 4.88 2.44 122 1093.12 1220
      H = 1 uM Pyo 9.76 2.44 122 1088.24 1220

      Mastermixes for Day 3 and Day 4:

      Condition V Pyo (uL) Kan (uL) LB 10x uL Autoclaved Water (uL) Tot Vol (uL)
      A = 2.5 uM Pyo 24.4 2.44 122 1073.6 1220
      B = 5 uM Pyo 48.8 2.44 122 1049.2 1220
      C = 10 uM Pyo 97.6 2.44 122 1000.4 1220
      D = 25 uM Pyo 244 2.44 122 854 1220
      E = 50 uM Pyo 488 2.44 122 610 1220
      F = 100 uM Pyo 976 2.44 122 122 1220

      We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:

      Condition Volume of A-H Mastermix (uL) Ampicillin (uL) Chloramphenicol (uL)
      PC1 + PC2 406 2.44 0
      + 203 0 2.44
      - 203 0 0
      Blanks 406 2.44 2.44
      This gave a total of 32 eppendorf tubes for Day 1 and 24 on Day 2, ready to be transferred into 96-well plates.
    3. Fill 96-well plate with media solutions

      4. Add 100 uL of media in the desired wells, according following the label on mastermixes and table below:

      1 2 3 4 5 6 7 8 9 10 11 12
      A PC1 PC1 BA PC2 PC2 BA - - BA + + BA
      B PC1 PC1 BB PC2 PC2 BB - - BB + + BB
      C PC1 PC1 BC PC2 PC2 BC - - BC + + BC
      D PC1 PC1 BD PC2 PC2 BD - - BD + + BD
      E PC1 PC1 BE PC2 PC2 BE - - BE + + BE
      F PC1 PC1 BF PC2 PC2 BF - - BF + + BF
      G PC1 PC1 BG PC2 PC2 BG - - BG + + BG
      H PC1 PC1 BH PC2 PC2 BH - - BH + + BH
    4. OD600 matching

      5. After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL

      Cell dilution calculator: Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells E.g. to dilute 5mL of cells at an OD600 of 0.3 to OD of 0.1 = [ (5mL*0.3)/0.1 - 5] =10 mL

    5. Add cells to 96-well plate

      6. We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.

    6. Set up the script in the plate reader and start experiment

      7. For Pyocyanin experiments:

      We set up a script on the BMG Labtech Omega control software to perform endpoint absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200.

    7. Data analysis

      8. We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments

    Electrochemistry of Redox Modulators

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Spatial Electronic Control of Gene Induction

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Creating the Sox Library

    Access All

    Description

    This protocol describes how to create a library of constructs varying two parts using BASIC assembly method. Following it we constructed a 48 constructs library, using 3 repeated parts and a variable promoter (pSoxS) with 8 variants, and a variable transcription factor (SoxR) with 6 variants (one of them unsubmitted to registry).

    Notes

    All the experiments for this part of the project were performed on E. coli DH5α, origin strain for DJ901, as this last one could not be made super-competent (109 cfu / μg pUC19 DNA) enough to transform BASIC assembly products. Individual parts were integrated in chloramphenicol resistant high copy plasmid pSB1C3_BASIC vectors and assemblies were performed in ampicillin resistant mid copy plasmid p15A vectors. All individual parts were synthesised and ordered as gblocks with BASIC prefix and suffix through IDT. The linkers used were provided by Biolegio and the adaptors were courtesy of Dr. Baldwin’s lab at Imperial College London.

    Part Promoter (for all 8 pSoxS) Transcription factor (for all 6 SoxR) Plasmid (p15A) Constitutive promoter (Pfam2-J23101) GFP
    Linker prefix LMP UTR2-3 LMS L5 UTR1-3
    Linker suffix UTR1-3 LMS LMP UTR2-3 L5
    Construct name Promoter (pSoxS) Transcription factor (SoxR) Plasmid Constitutive promoter GFP
    PC_A1 BBa_K2862006 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_A2 BBa_K2862006 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_A3 BBa_K2862006 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_A4 BBa_K2862006 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_A5 BBa_K2862006 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_A6 BBa_K2862006 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_B1 BBa_K2862007 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_B2 BBa_K2862007 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_B3 BBa_K2862007 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_B4 BBa_K2862007 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_B5 BBa_K2862007 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_B6 BBa_K2862007 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_C1 BBa_K2862008 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_C2 BBa_K2862008 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_C3 BBa_K2862008 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_C4 BBa_K2862008 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_C5 BBa_K2862008 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_C6 BBa_K2862008 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_D1 BBa_K2862009 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_D2 BBa_K2862009 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_D3 BBa_K2862009 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_D4 BBa_K2862009 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_D5 BBa_K2862009 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_D6 BBa_K2862009 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_E1 BBa_K2862010 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_E2 BBa_K2862010 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_E3 BBa_K2862010 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_E4 BBa_K2862010 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_E5 BBa_K2862010 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_E6 BBa_K2862010 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_F1 BBa_K2862011 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_F2 BBa_K2862011 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_F3 BBa_K2862011 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_F4 BBa_K2862011 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_F5 BBa_K2862011 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_F6 BBa_K2862011 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_G1 BBa_K2862012 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_G2 BBa_K2862012 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_G3 BBa_K2862012 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_G4 BBa_K2862012 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_G5 BBa_K2862012 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_G6 BBa_K2862012 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes
    PC_H1 BBa_K2862013 BBa_K2862014 P15A-Amp BBa_K2862019 Yes
    PC_H2 BBa_K2862013 BBa_K2862015 P15A-Amp BBa_K2862019 Yes
    PC_H3 BBa_K2862013 BBa_K2862016 P15A-Amp BBa_K2862019 Yes
    PC_H4 BBa_K2862013 BBa_K2862017 P15A-Amp BBa_K2862019 Yes
    PC_H5 BBa_K2862013 BBa_K2862018 P15A-Amp BBa_K2862019 Yes
    PC_H6 BBa_K2862013 SoxR-8 (not submitted)* P15A-Amp BBa_K2862019 Yes

    Figure 1. Table indicating the composition of each construct

    Procedure

    Parts assembly for library generation was performed as described in Storch, Casini et al., 2015. Briefly, linkers were prepared adding 49 µl of annealing buffer ( 10mM TRIS-HCl buffer pH7.9, 100mM NaCl, 10mM MgCl2 ) to 0.5 µl (1 µM) of linker and 0.5 µl (1 µM) of adapter oligos, and incubating at 95ºC for 1 min. Once linkers were ready they were mixed with the parts for the digestion/ligation reaction and incubated at 37ºC for 1 hour, 20ºC for 20 min, 65ºC for 20 min. Each 30 µl reaction had 3µl of ATP, 3µl of NEB4, 3µl BSA, 5µl of prefix linker (1µM), 5µl of suffix linker (1 µM), 1µl of BsaI (20 U/µl), 0.5 µl of T4 ligase (400 U/µl), 1µl DNA part (200 ng/µl) and water. Parts and linkers were mixed according to the following table.

    Characterising the Sox Library

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Testing Phenazine Methosulfate

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Biocontainment- Gp2 Growth Inhibition

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Fabric Bioprinting - Melanin

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.