(15 intermediate revisions by the same user not shown) | |||
Line 2: | Line 2: | ||
<html> | <html> | ||
<div class="column full_size"> | <div class="column full_size"> | ||
− | <h1> | + | <h1>BAPT</h1> |
− | <p> | + | <p><br> |
− | + | <h4>Name: </h4><br> | |
− | + | Phenylpropanoyltransferase (BAPT, TAX7) | |
− | < | + | <br><br> |
+ | <h4>Reaction: </h4><br> | ||
+ | baccatin III + (3R)-3-amino-3-phenylpropanoyl-CoA → N-debenzoyl-(3'-RS)-2'-deoxytaxol + coenzyme A | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Km: </h4><br> | ||
+ | 5.6 uM for (3R)-3-amino-3-phenylpropanoyl-CoA; | ||
+ | 68 uM for baccatin III; | ||
+ | 2.4 uM for baccatin III and 4.9 uM beta-phenylalanoyl-CoA (Thornburg, 2015) | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Kcat: </h4><br> | ||
+ | 0.0583 ± 0.0010 s<sup>-1</sup> (Thornburg, 2015) | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Enzyme Description: </h4><br> | ||
+ | BAPT is the enzyme that adds the C13 Taxol side chain partially formed to the Taxol backbone. It makes use of <br> | ||
+ | CoA chemistry to add the side chain to the 13’ hydroxyl group of baccatin III. | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Plasmid Map</h4><br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/parts/f/f9/T--Duke--PSB1C3-BAPT_Plasmid_Map.jpg" style="width:700px;height:550px;"></center> | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Sequence</h4><br> | ||
+ | atgaagaagactgggagtttcgcggagttccacgttaatatgatcgagcgcgtgatggttcgtccttgccttccttcacctaagactattttgcctttgt | ||
+ | ctgcgatcgataacatggcacgtgccttcagtaatgtcttactggtgtacgccgccaacatggatcgcgtcagcgcggacccggcaaaggttattcgtga | ||
+ | ggcgcttagcaaggtattggtctactattacccttttgctggccgcttgcgtaacaaagaaaatggagagcttgaagtggagtgcacaggacaaggagta | ||
+ | ttgtttttagaagccatggctgacagcgacctttcagtattaactgacctggacaactacaatcctagttttcagcagcttatctttagcttgccgcaag | ||
+ | ataccgacatcgaggatttgcatttgttgatcgtacaggtcacacgcttcacatgtggtgggtttgttgtcggtgctaacgtctatggttccgcctgtga | ||
+ | cgcaaaaggattcggtcaattcttacagtctatggcggagatggctcgcggagaagtaaagccctccatcgaaccaatctggaatcgcgaattggttaaa | ||
+ | cttgagcactgtatgccttttcgtatgtcacacttgcagattattcacgcgccagtcattgaggagaagtttgtccagacatcgcttgtgatcaacttcg | ||
+ | aaatcatcaaccatattcgtcgtcgcatcatggaagagcgtaaagagagcctgtcttctttcgaaattgttgccgcgttagtctggcttgcgaagattaa | ||
+ | ggcgtttcaaattccacattccgaaaatgtgaaactgctgttcgccatggacctgcgccgctctttcaatccgccgctgccccatgggtattatgggaat | ||
+ | gcatttgggatcgcttgcgcgatggacaacgtgcatgatctgttgtcgggtagcctgttgcgtaccattatgatcattaagaagtctaaattttccctgc | ||
+ | ataaagaattaaattctaagacagttatgagtagttccgtagtggatgtaaataccaaatttgaggacgttgtgtcgatctccgactggcgccacagcat | ||
+ | ttactacgaagtagactttggatggggagacgcaatgaatgtgagtacgatgcttcagcaacaagaacacgaaaaatcgctgccaacgtattttagtttt | ||
+ | ttgcaatcgaccaagaatatgcctgacggtatcaagatgttaatgtttatgcctcctagtaaacttaagaaatttaagattgaaatcgaagccatgatta | ||
+ | agaaatatgttacgaaggtatgcccttctaagctttgataa | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Design Notes</h4><br> | ||
+ | Part digested with XbaI and SpeI from vector designed by Duke's 2016 team and ligated into digested PSB1C3. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-HC-Amp vector. | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Source</h4><br> | ||
+ | |||
+ | Origin from Pacific Yew Tree, Taxus brevifolia | ||
+ | <br><br> | ||
+ | |||
+ | <h4>References</h4><br> | ||
+ | Thornburg, C. (2015). Development of a four-step semi-biosynthesis of the anticancer drug paclitaxel and its analogues (Doctoral dissertation, Michigan State University). | ||
+ | <br> <br> <br> <br> <br></p> | ||
</div> | </div> | ||
− | < | + | |
+ | <div class="column full_size"> | ||
+ | <h1>TAX10</h1> | ||
+ | <p><br> | ||
+ | <h4>Name: </h4><br> | ||
+ | 3'-N-debenzoyl-2'-deoxytaxol N-benzoyltransferase (TAX10, DBTNBT) | ||
+ | |||
+ | <br><br> | ||
+ | <h4>Reaction: </h4><br> | ||
+ | N-debenzoyl-(3'-RS)-taxol + benzoyl-CoA → Taxol + CoA + H<sup>+</sup> | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Km: </h4><br> | ||
+ | 420 uM for N-debenzoyl-(3'-RS)-taxol; | ||
+ | 400 uM for benzoyl-CoA (Walker, Long, & Croteau, 2002) | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Kcat: </h4><br> | ||
+ | 1.5 ± 0.3 s<sup>-1 </sup> (Walker, Long, & Croteau, 2002) | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Enzyme Description: </h4><br> | ||
+ | The final step of the Taxol biosynthesis pathway is the addition of another benzoyl ring to the Taxol C13 side <br> | ||
+ | chain. It makes use of a second benzoyl-CoA from the BadA enzyme production and makes use of the same <br> | ||
+ | chemistry but with different substrate specificity for the later Taxol intermediate. | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Plasmid Map</h4><br> | ||
+ | <center><img src="https://static.igem.org/mediawiki/parts/1/13/T--Duke--PSB1C3-tax10_Plasmid_Map.jpg" style="width:700px;height:550px;"></center> | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Sequence</h4><br> | ||
+ | aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaaccatgcaccatcaccatcaccatgagaaagcaggttccaccgactttcac | ||
+ | gtaaaaaagttcgatcccgtaatggtcgctccttcgctgccgagcccaaaggcgaccgtccagttatcggtggtggattctctgaccatctgccgtggga | ||
+ | tctttaatactttattggtttttaacgcaccagacaatatcagcgcagacccggtaaagattatccgtgaagcacttagtaaagtcttggtatattactt | ||
+ | tccacttgcgggccgcttgcgttcgaaggagatcggtgaacttgaggtcgagtgtacgggcgatggcgcacttttcgtcgaagccatggtcgaggatacg | ||
+ | atttcggttttacgtgacttagatgatcttaacccttcattccaacaacttgtgttttggcatccgttagatacggcgatcgaagatttacatcttgtca | ||
+ | tcgtccaagttacgcgtttcacctgtggcggtattgccgttggcgtgacacttccacatagcgtatgcgacgggcgtggtgcggctcaattcgtcaccgc | ||
+ | attagctgaaatggcacgcggagaggtcaaaccctctcttgagccaatttggaatcgtgaattgctgaaccccgaagaccctttgcatcttcagcttaac | ||
+ | caatttgattctatctgccctccccctatgttagaggaacttggacaagcatcatttgtgatcaacgttgacactatcgaatacatgaaacaatgtgtga | ||
+ | tggaagagtgcaatgagttttgctcatcgttcgaagtagtggcagcacttgtatggattgctcgcactaaggcattacaaattccacacacagagaatgt | ||
+ | caagcttctgtttgctatggaccttcgcaagttgtttaatccacctctgccgaatggctactatggcaacgctatcggcaccgcgtacgccatggataat | ||
+ | gttcaagacttgttaaatgggagccttcttcgtgcgattatgattatcaaaaaggcgaaggctgatttgaaagataattacagtcgttcgcgcgtcgtca | ||
+ | caaacccgtacagtttggacgttaataagaaaagtgacaacatccttgcgttaagtgattggcgtcgcctgggtttctacgaagcggatttcgggtgggg | ||
+ | tggtcctctgaacgtatcgtcacttcagcgtttagagaacggtctgccaatgttctcaacgtttctgtatctgttaccggctaagaacaaatctgatggt | ||
+ | attaaactgcttctgagttgcatgcctccaacgactttgaaatcgttcaaaattgtaatggaggccatgattgagaagtacgtgagtaaggtatagtaa | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Design Notes</h4><br> | ||
+ | Part digested with XbaI and SpeI from vector designed by Duke's 2016 team and ligated into digested PSB1C3. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-LC-Kan vector. | ||
+ | <br><br> | ||
+ | |||
+ | <h4>Source</h4><br> | ||
+ | |||
+ | Origin from Pacific Yew Tree, Taxus brevifolia | ||
+ | <br><br> | ||
+ | |||
+ | <h4>References</h4><br> | ||
+ | Walker, K., Long, R., & Croteau, R. (2002). The final acylation step in Taxol biosynthesis: Cloning of the taxoid C13-side-chain N-benzoyltransferase from Taxus. Proceedings of the National Academy of Sciences of the United States of America, 99(14), 9166–9171. http://doi.org/10.1073/pnas.082115799 | ||
+ | <br> </p> | ||
+ | </div> | ||
+ | |||
<!-- | <!-- |
Latest revision as of 20:27, 17 October 2018
BAPT
Name:
Phenylpropanoyltransferase (BAPT, TAX7)
Reaction:
baccatin III + (3R)-3-amino-3-phenylpropanoyl-CoA → N-debenzoyl-(3'-RS)-2'-deoxytaxol + coenzyme A
Km:
5.6 uM for (3R)-3-amino-3-phenylpropanoyl-CoA; 68 uM for baccatin III; 2.4 uM for baccatin III and 4.9 uM beta-phenylalanoyl-CoA (Thornburg, 2015)
Kcat:
0.0583 ± 0.0010 s-1 (Thornburg, 2015)
Enzyme Description:
BAPT is the enzyme that adds the C13 Taxol side chain partially formed to the Taxol backbone. It makes use of
CoA chemistry to add the side chain to the 13’ hydroxyl group of baccatin III.
Plasmid Map
Sequence
atgaagaagactgggagtttcgcggagttccacgttaatatgatcgagcgcgtgatggttcgtccttgccttccttcacctaagactattttgcctttgt ctgcgatcgataacatggcacgtgccttcagtaatgtcttactggtgtacgccgccaacatggatcgcgtcagcgcggacccggcaaaggttattcgtga ggcgcttagcaaggtattggtctactattacccttttgctggccgcttgcgtaacaaagaaaatggagagcttgaagtggagtgcacaggacaaggagta ttgtttttagaagccatggctgacagcgacctttcagtattaactgacctggacaactacaatcctagttttcagcagcttatctttagcttgccgcaag ataccgacatcgaggatttgcatttgttgatcgtacaggtcacacgcttcacatgtggtgggtttgttgtcggtgctaacgtctatggttccgcctgtga cgcaaaaggattcggtcaattcttacagtctatggcggagatggctcgcggagaagtaaagccctccatcgaaccaatctggaatcgcgaattggttaaa cttgagcactgtatgccttttcgtatgtcacacttgcagattattcacgcgccagtcattgaggagaagtttgtccagacatcgcttgtgatcaacttcg aaatcatcaaccatattcgtcgtcgcatcatggaagagcgtaaagagagcctgtcttctttcgaaattgttgccgcgttagtctggcttgcgaagattaa ggcgtttcaaattccacattccgaaaatgtgaaactgctgttcgccatggacctgcgccgctctttcaatccgccgctgccccatgggtattatgggaat gcatttgggatcgcttgcgcgatggacaacgtgcatgatctgttgtcgggtagcctgttgcgtaccattatgatcattaagaagtctaaattttccctgc ataaagaattaaattctaagacagttatgagtagttccgtagtggatgtaaataccaaatttgaggacgttgtgtcgatctccgactggcgccacagcat ttactacgaagtagactttggatggggagacgcaatgaatgtgagtacgatgcttcagcaacaagaacacgaaaaatcgctgccaacgtattttagtttt ttgcaatcgaccaagaatatgcctgacggtatcaagatgttaatgtttatgcctcctagtaaacttaagaaatttaagattgaaatcgaagccatgatta agaaatatgttacgaaggtatgcccttctaagctttgataa
Design Notes
Part digested with XbaI and SpeI from vector designed by Duke's 2016 team and ligated into digested PSB1C3. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-HC-Amp vector.
Source
Origin from Pacific Yew Tree, Taxus brevifolia
References
Thornburg, C. (2015). Development of a four-step semi-biosynthesis of the anticancer drug paclitaxel and its analogues (Doctoral dissertation, Michigan State University).
TAX10
Name:
3'-N-debenzoyl-2'-deoxytaxol N-benzoyltransferase (TAX10, DBTNBT)
Reaction:
N-debenzoyl-(3'-RS)-taxol + benzoyl-CoA → Taxol + CoA + H+
Km:
420 uM for N-debenzoyl-(3'-RS)-taxol; 400 uM for benzoyl-CoA (Walker, Long, & Croteau, 2002)
Kcat:
1.5 ± 0.3 s-1 (Walker, Long, & Croteau, 2002)
Enzyme Description:
The final step of the Taxol biosynthesis pathway is the addition of another benzoyl ring to the Taxol C13 side
chain. It makes use of a second benzoyl-CoA from the BadA enzyme production and makes use of the same
chemistry but with different substrate specificity for the later Taxol intermediate.
Plasmid Map
Sequence
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaaccatgcaccatcaccatcaccatgagaaagcaggttccaccgactttcac gtaaaaaagttcgatcccgtaatggtcgctccttcgctgccgagcccaaaggcgaccgtccagttatcggtggtggattctctgaccatctgccgtggga tctttaatactttattggtttttaacgcaccagacaatatcagcgcagacccggtaaagattatccgtgaagcacttagtaaagtcttggtatattactt tccacttgcgggccgcttgcgttcgaaggagatcggtgaacttgaggtcgagtgtacgggcgatggcgcacttttcgtcgaagccatggtcgaggatacg atttcggttttacgtgacttagatgatcttaacccttcattccaacaacttgtgttttggcatccgttagatacggcgatcgaagatttacatcttgtca tcgtccaagttacgcgtttcacctgtggcggtattgccgttggcgtgacacttccacatagcgtatgcgacgggcgtggtgcggctcaattcgtcaccgc attagctgaaatggcacgcggagaggtcaaaccctctcttgagccaatttggaatcgtgaattgctgaaccccgaagaccctttgcatcttcagcttaac caatttgattctatctgccctccccctatgttagaggaacttggacaagcatcatttgtgatcaacgttgacactatcgaatacatgaaacaatgtgtga tggaagagtgcaatgagttttgctcatcgttcgaagtagtggcagcacttgtatggattgctcgcactaaggcattacaaattccacacacagagaatgt caagcttctgtttgctatggaccttcgcaagttgtttaatccacctctgccgaatggctactatggcaacgctatcggcaccgcgtacgccatggataat gttcaagacttgttaaatgggagccttcttcgtgcgattatgattatcaaaaaggcgaaggctgatttgaaagataattacagtcgttcgcgcgtcgtca caaacccgtacagtttggacgttaataagaaaagtgacaacatccttgcgttaagtgattggcgtcgcctgggtttctacgaagcggatttcgggtgggg tggtcctctgaacgtatcgtcacttcagcgtttagagaacggtctgccaatgttctcaacgtttctgtatctgttaccggctaagaacaaatctgatggt attaaactgcttctgagttgcatgcctccaacgactttgaaatcgttcaaaattgtaatggaggccatgattgagaagtacgtgagtaaggtatagtaa
Design Notes
Part digested with XbaI and SpeI from vector designed by Duke's 2016 team and ligated into digested PSB1C3. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-LC-Kan vector.
Source
Origin from Pacific Yew Tree, Taxus brevifolia
References
Walker, K., Long, R., & Croteau, R. (2002). The final acylation step in Taxol biosynthesis: Cloning of the taxoid C13-side-chain N-benzoyltransferase from Taxus. Proceedings of the National Academy of Sciences of the United States of America, 99(14), 9166–9171. http://doi.org/10.1073/pnas.082115799