Difference between revisions of "Team:Bielefeld-CeBiTec/siRNA Results"

Line 151: Line 151:
  
 
<article>
 
<article>
−
While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6.  
+
While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. This construct prevents false positive results generated by non-functional reporter proteins, as the absorption increases with higher silencing activity instead of decreasing with higher silencing effectivity.  
 
</article>
 
</article>
  
Line 161: Line 161:
 
   </figcaption>
 
   </figcaption>
 
</figure>
 
</figure>
 +
 +
<article>
 +
 +
</article>
 +
 +
 
<article>
 
<article>
 
All Vectors with corresponding linkers and reporter proteins can be found in Table 1:
 
All Vectors with corresponding linkers and reporter proteins can be found in Table 1:

Revision as of 23:30, 17 October 2018

The Tace System - Functionality and Usage
Tace: lat. Silence!

Abstract

We designed and build a two-vector system to express and test siRNAs using homologe E. coli proteins. Because of major difficulties during this process we had not enough time to test the system extensively. The System is designed to test multiple siRNAs in high throughout mode and offers expression vectors with integrated RNA sequences that can be used to add additional functionalities to an siRNA. Two Generations of Target vectors were designed. See how to apply the Tace system to your projekt below.

The Tace system

RNA interference (RNAi) is a largely used alternative to other known knock-out-systems like CRISPR/Cas. That is why we established an easy-to-use siRNA-system for iGEM. Due to the fact that it is complicated and expensive to run multiple RNA quantification and RNA purification experiments we constructed a vector-system, TACE, to express and validate different siRNAs in vivo. The whole system is designed to test several siRNAs with a high sample throughput to select the perfect siRNA for the specific knock-out. There are several possibilities to adapt the siRNA to personal needs like overlaps or different additions. For an easier design of the perfect siRNA we created an siRNA constructor (siRCon) which is able to construct the best siRNA for every target gene.
We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA. It is important to make all expressed siRNAs comparable to each other. Therefore we designed four Biobricks featuring the same promoter to establish the same expression rate for all siRNAs. As a first Generation, we designed the four Biobricks BBa_K2638701, BBa_K2638702, BBa_K2638758 and BBa_K2638759 (Figure 1-4) for our expression vectors. They contain a Golden Gate Assembly (GGA) cassette which can be cut out using the restriction enzyme BbsI. So it is possible to replace the whole GGA cassette with a specific siRNA with the usage of our GGA protocol. The transcription of the siRNA is terminated by the strong Terminator BBa_B0015 to make sure that all expression processes are completely terminated. While the Biobrick BBa_K2638701 (Figure 1) is supposed to transcribe an siRNA without further modifications, the Biobrick BBa_K2638702 (Figure 2) also includes the Hfq binding sequence originating of the MicC-siRNA. The Biobrick BBa_K2638758 (Figure 3) contains the 5’-UTR from ompA as a protective sequence upstream of the siRNA insertion site and the Biobrick BBa_K2638759 (Figure 4) with both features surrounding the insertion site as well as sequences combined to add further functions to the siRNA.
Figure 1: Illustration of Biobrick BBa_K2638701, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA into the Vector.
Figure 2: Illustration of Biobrick BBa_K2638702, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA to the Hfq binding Sequence inside the expression Vector.
Figure 3: Illustration of Biobrick BBa_K26387058, an expression Vector for siRNAs. The Biobrick includes a golden Gate Cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (5’ UTR) upstream of the site of insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend breakdown.
Figure 4: Illustration of Biobrick BBa_K26387059, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (UTR)upstream, and the Hfq binding Sequence downstream of the site of siRNA insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend breakdown.
Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The expression vector itself is complemented by a target vector, pTale, which transcribes one specific mRNA. The chosen mRNA should be silenced by the constructed siRNAs using one of the described Biobricks above. To get the optimal conditions for measuring the silencing effect of our siRNA we scheduled and constructed two Generations of target vectors. For the first generation of the target vectors we used two different Reporter Proteins: the chromoprotein AmilCp (BBa_K592009) and the blue fluorescent protein BFP (BBa_K592100). Additionaly feature the target Biobrick a linker between the GGA cassette and the reporter protein. This way, the inserted target mRNA forms a CDS fusion with the reporter protein without losing any function. If the mRNA is destroyed, no reporter protein is formed. This results in no measurement of the BFP fluorescents which is proportional to the silencing strength of the siRNA. The Target Vectors were cloned with 4 different linkers (GGGGS, BBa_K26387021; EAAAK, BBa_K26387022; XP, BBa_K26387023; cMyc, BBa_K26387024), so users of this System can choose the perfect linker for their own system. The structure of the first generation of pTale is shown in Figure 5.
Figure 5: Structure of the first generationof the target vector pTale. Four different Linkers were cloned. BFP and AmilCP were tested as Reporter Proteins. The Golden Gate Cassette, the Linker and the reporter protein form a fused unit and do not contain Biobrick scars.
While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. This construct prevents false positive results generated by non-functional reporter proteins, as the absorption increases with higher silencing activity instead of decreasing with higher silencing effectivity.
Figure 6: Structure of the second generation of the target vector pTale. The Golden Gate Cassette, the Linker and the LacI inhibitor are fused and do not feature scars between parts.
All Vectors with corresponding linkers and reporter proteins can be found in Table 1:
Table 1: List of Expression vectors (pGuide) and target vectors (pTale) that were constructed in this project and their corresponding linkers, reporter proteins and other features.
Biobrick number Tag Linker Reporter Protein Other features
BBa_K2638711 pTale_A_GS GGGGS AmilCP -
BBa_K2638712 pTale_A_EA EAAAK AmilCP -
BBa_K2638713 pTale_A_CM cMyc AmilCP -
BBa_K2638714 pTale_A_XP XP AmilCP -
BBa_K2638707 pTale_B_GS GGGGS BFP -
BBa_K2638708 pTale_B_EA EAAAK BFP -
BBa_K2638709 pTale_B_CM cMyc BFP -
BBa_K2638710 pTale_B_XP XP BFP -
BBa_K2638707 pTale2_B_GS GGGGS BFP 2. Generation
BBa_K2638708 pTale2_B_EA EAAAK BFP 2. Generation
BBa_K2638709 pTale2_B_CM cMyc BFP 2. Generation
BBa_K2638710 pTale2_B_XP XP BFP 2. Generation
BBa_K2638701 pGuide - - -
BBa_K2638702 pGuide_Hfq - - Hfq scaffold
BBa_K2638758 pGuide_Omp - - OmpA 5’-UTR
BBa_K2638759 pGuide_Hfq_Omp - - Hfq Scaffold, Hfq Scaffold

Testing the System

As we had great difficulties to assemble the vectors, we had very little time left to test the system. Amongst other small hinderances, major faults in IDT gene syntheses were the cause of great time losses. In the end we were able to assemble and transform all vectors belonging to the system. We were able to test the Target vectors cloning GFP as a target sequence into all target vectors. The OD600 and the fluorescence of BFG and GFP were measured in 96 well plates as described in the usage Protocol below using a Teacon reader. 3 replicates were measured for each sample. The results of the measurement of pTale1_B_CM are in figures 7 and 8 shown below. Two clones were tested, one of them showing expression of BFP, and one showing expression of GFP. No clones expressing both proteins were detected
Figure 7: Meassurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. 3 replicates ware measured for each sample. The measured clone was sequenced, showing that only 50 BP of GFB were inserted as target sequence.
Figure 8: Meassurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. 3 replicates ware measured for each sample. The measured clone was sequenced, showing that a complete GFB was inserted as target sequence.

Usage protocol

Figure 9: Schematic that shows how to use our siRNA Testing System.
All experiments should be conducted in an E. coli strain producing the TetR repressor. Alternatively, a construct producing TetR can be cloned into the pTale vectors.
  1. Prepare Biobricks
    To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore, the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of iGEM Vilnius 2017 are extremely useful for this purpose.

  2. Preparation of the target sequences
    Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence.
      There are two ways to clone a target sequence into a target vector:
    • By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.
    • -By Golden Gate assembly: Specially suitable for short target sequences which can be ordered as oligonucleotides, as overlaps of 4 nucleotides are needed to assemble the vector. Dimerize the oligos by Oligo Annealing and perform the Golden Gate assembly as described in our protocols. This might be useful when only a fragment of a coding sequence is used as a target sequence.
    • To screen several vectors for the best compartibility with a target sequence transform all vectors with the Target gene inserted.
    • For pTale vectors: induce with anhydrotetracycline (ahTc) and compare the levels of formed protein markers.
    • For pTale2: Induce with IPTG. Let the cells grow until the BFP can be detected. Induce with ahTc and measure and compare the decline of the BFPs fluorescence to find out if a correctly folded LacI fusion is expressed.
    • Once a target vector is chosen, prepare competent cells harboring this vector.

  3. Design siRNAs
    • Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the pGuide_Omp vector (BBa_....), as the OmpA 5’-untranslated region (UTR) significantly increases the half-life of the siRNA. The Hfq adapting scaffold present in the Expression vectors pGuide_Hfq and pGuide_OmpA_Hfq is recommendable in most cases, as it protects the siRNA and strengthens the bond to the target sequence. The vector used determines which overlaps to the vector need to be included into the siRNAs. The overlaps for the different vectors can be seen in Table 3.
    • Design the siRNAs. Either by using our tool to predict siRNAs (siRCon [Hyperlink]), or by adapting externally designed siRNAs to our system.
    • Order siRNAs as Oligonucleotides

  4. Transformation and measurement
    • Perform an oligoannealing and a Golden Gate assembly as described in our protocols to insert the siRNAs into the expression vector.
    • Transform the Golden Gate Assembly into the competent cells containing the target vector.
    • Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.
Table 2: Primers for sequencing, colony PCR and amplification of the Tace vectors.
Vektor Linker Forward Primer Reverse Primer Tm
pGuide - gattatttgcacggcgtcac gaggaagcctgcataacgc 57°C
pTale1_BFP all gtgatagagattgacatccctatcagtg ccctgagtatggttaatgaacgttttg 57°C
pTale1_AmilCP all gtgatagagattgacatccctatcagtg cagtgagctttaccgtctgc 57°C
pTale2 all gtgatagagattgacatccctatcagtg gtggcaacgccaatcagc 57°C
pTale2_amplification GGGGS GGGGGTGGAGGTTCGG CATctttcctgtgtgagtgctcag 57°C
pTale2_amplification EAAAK GAGGCGGCTGCAAAAGAG CATctttcctgtgtgagtgctcag 57°C
pTale2_amplification cMyc GAACAGAAGCTGATTAGCGAAGAAG CATctttcctgtgtgagtgctcag 57°C
pTale2_amplification XP GCTCCCGCTCCGAAGC CATctttcctgtgtgagtgctcag 57°C
pTale1_ amplification GGGGS GGGGGTGGAGGTTCGG CATctttcctgtgtgagtgctcag 57°C
pTale1_ amplification EAAAK GAGGCGGCTGCAAAAGAG CATctttcctgtgtgagtgctcag 57°C
pTale1_ amplification xMyc GAACAGAAGCTGATTAGCGAAGAAG CATctttcctgtgtgagtgctcag 57°C
pTale1_ amplification XP GCTCCCGCTCCGAAGC CATctttcctgtgtgagtgctcag 57°C
Table 3: Table 3: The overlaps needed to insert DNA into several vectors.
Vektor Linker Forward overlap Reverse overlap
pTale1, pTale2 GGGGS GATG CCCC
pTale1, pTale2 EAAAK GATG CCTC
pTale1, pTale2 cMyc GATG GTTC
pTale1, pTale2 XP GATG GAGC