Difference between revisions of "Team:William and Mary/3GProtocols"

 
(49 intermediate revisions by 4 users not shown)
Line 13: Line 13:
 
</head>
 
</head>
 
<body style="margin:30px 30px 30px 30px;font-size: 15px">
 
<body style="margin:30px 30px 30px 30px;font-size: 15px">
<br></br>
+
<div style='padding-top: 20px;'></div>
 
<h1 style="color:black;text-align:center;">3G Assembly Protocols</h1>
 
<h1 style="color:black;text-align:center;">3G Assembly Protocols</h1>
 
<div style='padding-top: 15px;'></div>
 
<div style='padding-top: 15px;'></div>
 +
 +
<center>
 +
<img src="https://static.igem.org/mediawiki/2018/6/65/T--William_and_Mary--Protocols_img.gif" style="width:17%;">
 +
</center>
 +
 +
<div style='padding-top: 20px;'></div>
  
 
<div style = 'padding-left: 8%; padding-bottom: 10px;font-size: 25px' ><b>Overview</b></div>
 
<div style = 'padding-left: 8%; padding-bottom: 10px;font-size: 25px' ><b>Overview</b></div>
Line 23: Line 29:
  
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
3G assembly is a new and cutting edge hybrid method of DNA assembly first described in 2018 by A. D. Halleran, A. Swaminathan and R. M, Murray [1] combines Golden Gate and Gibson to allow for modular assembly of multi-part circuits in a single day. In this method circuits are composed of modular transcriptional units which are constructed using Golden Gate Assembly. These transcriptional units are amplified with PCR, purified via gel extraction, then combined into a circuit using Gibson Assembly.  
+
3G assembly is a new and cutting edge hybrid method of DNA assembly first described in 2018 by A. D. Halleran, A. Swaminathan and R. M, Murray [1] which combines Golden Gate and Gibson assembly techniques to allow for modular assembly of multi-part circuits in a single day. In this method circuits are composed of modular transcriptional units which are constructed using Golden Gate Assembly. These transcriptional units are amplified with PCR, purified via gel extraction, then combined into a circuit using Gibson Assembly.  
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
 
<center>
 
<center>
<figure style='padding-left: 200px;'>
+
<figure style='padding-left: px;'>
<img src='' height = "70%" width = "70%"/>
+
<img src="https://static.igem.org/mediawiki/2018/3/30/T--William_and_Mary--3goverview.png" width = "50%"/>
<figcaption><div style='padding-left: 5px;padding-top: 15px; color: #808080; font-size: 14px;'>An overview of 3G Assembly.</div></figcaption>
+
<figcaption><div style='padding-left: 20%;padding-right:20%; padding-top: 15px; color: #808080; font-size: 14px;'>
 +
Figure 1: Overview of 3G workflow
 +
</div></figcaption>
 
</figure>
 
</figure>
 
</center>
 
</center>
Line 42: Line 50:
  
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
A circuit is composed of transcriptional units. Each transcriptional unit consists of a promoter, a 5’ untranslated region (UTR), a coding sequence (CDS), and a terminator in that order. Each of these four parts have distinct sticky ends according to the Cidar Modular Cloning System, which can be seen in the table below:
+
A circuit is composed of transcriptional units. Each transcriptional unit consists of a promoter, a 5’ untranslated region (UTR), a coding sequence (CDS), and a terminator in that order. Each of these four parts have distinct sticky ends according to the Cidar Modular Cloning System, which can be seen in the image below:
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
 +
 +
<center>
 +
<figure style='padding-left: px;'>
 +
<img src="https://static.igem.org/mediawiki/2018/a/a5/T--William_and_Mary--gg1actual.png" width = "50%"/>
 +
<figcaption><div style='padding-left: 20%;padding-right:20%; padding-top: 15px; color: #808080; font-size: 14px;'>
 +
Figure 2: Schematic of MoClo Sticky Ends of promoters, 5' UTRs, CDSs and terminators
 +
</div></figcaption>
 +
</figure>
 +
</center>
 +
<div style='padding-top: 50px;'></div>
  
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
Line 62: Line 80:
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
 +
 +
<center>
 +
<figure style='padding-left: px;'>
 +
<img src="https://static.igem.org/mediawiki/2018/d/de/T--William_and_Mary--gibsonstage.png"width="700" height="400">
 +
<figcaption><div style='padding-left: 20%;padding-right:20%; padding-top: 15px; color: #808080; font-size: 14px;'>
 +
Figure 3: Gibson stage of 3G: Transcriptional units attach to the backbone at UNS 1 and UNS 10 and to each other at overlapping UNS
 +
</div></figcaption>
 +
</figure>
 +
</center>
 +
 +
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
Transcriptional units are either supplied from the iGEM registry or can be designed. They may need to be cloned on a backbone in order to increase volume. Oligo adapters are then added.  
 
Transcriptional units are either supplied from the iGEM registry or can be designed. They may need to be cloned on a backbone in order to increase volume. Oligo adapters are then added.  
Line 76: Line 105:
 
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 
<div style='padding-top: 0px;'></div>
 
<div style='padding-top: 0px;'></div>
 
<div style='padding-top: 20px;'></div>
 
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
Single stranded lyophilized oligos (see table below) are resuspending in IDT duplex buffer to a concentration of 100 uM. Top and bottom oligos are combined in a 1:1 molar ratio in duplex buffer to a final concentration of 1µM and then annealed by heating to 98C for 1 minute and then cool to room temperature on the benchtop. 50 nM working stocks are created by a 1:20 dilution of the 1µM stock in NFW.  
+
Single stranded lyophilized oligos (see table in Additional Information) are resuspending in IDT duplex buffer to a concentration of 100 uM. Top and bottom oligos are combined in a 1:1 molar ratio in duplex buffer to a final concentration of 1µM and then annealed by heating to 98C for 1 minute and then cool to room temperature on the benchtop. 50 nM working stocks are created by a 1:20 dilution of the 1µM stock in NFW.  
 
</div>
 
</div>
 +
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
 
<h1>Preparation of UNS1/10 iGEM Backbones</h1>
+
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Preparation of UNS1/10 iGEM Backbones</b></div>
</div>
+
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
The UNS1/10 iGEM backbones can be prepared by a standard PCR. To a .2 mL tube, add<br><br>
+
The UNS1/10 iGEM backbones can be prepared by a standard PCR. To a 0.2 mL tube, add:</div>
-1.25 µL primer BBa_K2680513<br>
+
-1.25 µL primer BBa_K2680514 <br>
+
- 9 µl NFW, 1 ul of a miniprep of either pSB1C3 or pSB3K3<br>
+
- 12.5 µl of Q5 2x Master Mix. <br><br>
+
Program the thermocycler with standard PCR cycles with a 55 C annealing temperature and a 1 minute extension time for pSB1C3, or a 1 minute 30 second extension time for  pSB3K3. Gel extract the PCR product.
+
  
</div>
 
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
<h1>Preparation of 30 nM 3G parts</h1>
+
<ul>
 +
<li>1.25 µL primer BBa_K2680513</li>
 +
<li>1.25 µL primer BBa_K2680514 </li>
 +
<li>9 µl NFW, 1 ul of a miniprep of either pSB1C3 or pSB3K3</li>
 +
<li>12.5 µl of Q5 2x Master Mix.</li>
 +
</ul>
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
 +
 +
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
 +
Program the thermocycler with standard PCR cycles with a 55 C annealing temperature and a 1 minute extension time for pSB1C3, or a 1 minute 30 second extension time for  pSB3K3. Gel extract the PCR product.</div>
 +
 +
<div style='padding-top: 20px;'></div>
 +
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Preparation of 30 nM 3G parts</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
Quantify the concentration of the miniprepped 3G part with a nanodrop, convert to molarity, then dilute to 30 nM in nuclease free water.  
 
Quantify the concentration of the miniprepped 3G part with a nanodrop, convert to molarity, then dilute to 30 nM in nuclease free water.  
 
</div>
 
</div>
<div style='padding-top: 20px;'></div>
+
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<h1>Golden Gate Assembly</h1>
+
</div>
+
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
 +
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Golden Gate Assembly</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
  
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
To a 0.2 mL tube, add the following:<br><br>
+
To a 0.2 mL tube, add the following:</div>
  
0.5 µL promoter 30 nM miniprep stock<br>
+
<div style='padding-top: 20px;'></div>
0.5 µL 5’ UTR 30 nM miniprep stock<br>
+
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
0.5 µL CDS 30 nM miniprep stock<br>
+
<ul>
0.5 µL terminator 30 nM miniprep stock<br>
+
<li>0.5 µL promoter 30 nM miniprep stock</li>
0.5 µL 50 nM left UNS adapter<br>
+
<li>0.5 µL 5’ UTR 30 nM miniprep stock</li>
0.5 uL 50 nM right UNS adapter<br><br>
+
<li>0.5 µL CDS 30 nM miniprep stock</li>
 +
<li>0.5 µL terminator 30 nM miniprep stock</li>
 +
<li>0.5 µL 50 nM left UNS adapter</li>
 +
<li>0.5 uL 50 nM right UNS adapter</li>
 +
</ul>
 +
</div>
 +
<div style='padding-top: 20px;'></div>
  
In addition, either add:<br><br>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
 +
In addition, either add:</div>
  
0.5 µL 10x DNA ligase buffer<br>
+
<div style='padding-top: 20px;'></div>
0.25 µL BsaI<br>
+
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
0.25 µL T4 DNA Ligase<br>
+
<ul>
1 µL NFW<br><br>
+
<li>0.5 µL 10x DNA ligase buffer</li>
 
+
<li>0.25 µL BsaI</li>
OR<br><br>
+
<li>0.25 µL T4 DNA Ligase</li>
 
+
<li>1 µL NFW</li>
0.5 µL Golden Gate Buffer<br>
+
</ul>
0.25 µL NEB Golden Gate Master Mix<br>
+
</div>
1.25 µL NFW<br><br>
+
<div style='padding-top: 20px;'></div>
  
Note: if performing multiple Golden Gate reactions, it may be easier to make a mastermix with a slight upscale, then add 2 µL of the master mix to reaction.<br><br>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
Cycle the reaction in the thermocycler. For the Golden Gate Master Mix perform 30 cycles of incubating at 37 for 1 minute then incubating at 16 C for one minute. For the T4 ligase and BsaI, perform 9 cycles at 37C for 3 minutes followed by incubating at 16 C for 4 minutes. For both options, hold at 37 C for five minutes, then hold at 4 C.
+
OR</div>
  
 +
<div style='padding-top: 20px;'></div>
 +
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
 +
<ul>
 +
<li>0.5 µL Golden Gate Buffer</li>
 +
<li>0.25 µL NEB Golden Gate Master Mix</li>
 +
<li>1.25 µL NFW</li>
 +
</ul>
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
<h1>PCR Amplification</h1>
+
Note: if performing multiple Golden Gate reactions, we recommend making a <b>master mix</b> with a slight upscale, then add 2 µL of the master mix to reaction.<br><br>
 +
Cycle the reaction in the thermocycler. For the Golden Gate Master Mix perform 30 cycles of incubating at 37 for 1 minute then incubating at 16 C for one minute. For the T4 ligase and BsaI, perform 9 cycles at 37C for 3 minutes followed by incubating at 16 C for 4 minutes. For both options, hold at 37 C for five minutes, then hold at 4 C.
 +
For information on creating multiple circuit variants at once, see <a href='https://2018.igem.org/Team:William_and_Mary/3G_Mixed' style="color:green">parallel 3G Assembly</a>.
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
 +
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>PCR Amplification</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
  
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
Amplify the product with a 50 uL PCR as according to the PCR protocol. Add<br><br>
+
Amplify the product with a 50 uL PCR as according to the PCR protocol. Add: </div>
-1.5 uL Golden Gate assembly product,<br>
+
 
-18.5 uL NFW,<br>
+
<div style='padding-top: 20px;'></div>
-2.5 uL of the appropriate 10uM UNS_foward Primer (that will anneal to the UNS on the 5’ end of your transcriptional unit),<br>
+
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
-2.5 uL 10 uM of the appropriate UNS_reverse primer (that will anneal to the UNS on the 3’ end of your transcriptional unit),<br>
+
<ul>
  -25 uL 2x Hot Start Master Mix.<br><br>
+
<li>1.5 µL Golden Gate assembly product</li>
 +
<li>18.5 µL NFW</li>
 +
<li>2.5 µL of the appropriate 10uM UNS_foward Primer (that will anneal to the UNS on the 5’ end of your transcriptional unit)</li>
 +
<li>2.5 µL 10 uM of the appropriate UNS_reverse primer (that will anneal to the UNS on the 3’ end of your transcriptional unit)</li>
 +
  <li>25 µL 2x Hot Start Master Mix </li>
 +
</ul>
 +
</div>
 +
<div style='padding-top: 20px;'></div>
 
   
 
   
Incubate reactions using the standard 2x Q5 Hot Start Master Mix protocol with 27 cycles, using 30 seconds per kilobase pair, and an annealing temperature of 64 C. Conduct a gel extraction on the PCR product.
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
 +
Incubate reactions using the standard 2x Q5 Hot Start Master Mix protocol with 27 cycles, using 30 seconds per kilobase pair, and an annealing temperature of 64 C. Conduct a gel extraction on the PCR product. (Note that 3G often produces off target bands as well as an extremely bright on target band. This is normal, and is why gel extraction rather than PCR purification is recommended).  
 
</div>
 
</div>
 +
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
 
<h1>Gibson Assembly</h1>
+
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Gibson Assembly</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
 +
 
 +
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
 +
Perform a 5 uL Gibson assembly using the purified transcriptional units and vectors. Add to a .2 mL tube:</div>
 +
<div style='padding-top: 20px;'></div>
 +
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 0px;line-height: 25px;'>
 +
<ul>
 +
<li>.015 pmolar each fragment</li>
 +
<li>.015 pmolar desired backbone</li>
 +
<li>Add NFW to a total volume of 2.5 µL.</li>
 +
<li>2.5 ul 2X HiFi DNA Assembly master mix</li>
 +
</ul>
 
</div>
 
</div>
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
<div style = 'padding-right: 14%; padding-left: 14%; line-height: 25px;'>
Perform a 5 uL Gibson assembly using the purified transcriptional units and vectors. Add to a .2 mL tube:<br><br>
+
-.015 pmolar each fragment<br>
+
-.015 pmolar desired backbone<br>
+
- Add NFW to a total volume of 2.5 µL.<br>
+
- 2.5 ul 2X HiFi DNA Assembly master mix.<br><br>
+
 
Ensure the total fragment volume of the PCR product and backbone does not exceed 2.5 µl. Place tube in a thermocycler, run for 50 C for an hour, and hold at 4 C. Proceed to a transformation fairly quickly as Gibson products are only stable for a few hours.
 
Ensure the total fragment volume of the PCR product and backbone does not exceed 2.5 µl. Place tube in a thermocycler, run for 50 C for an hour, and hold at 4 C. Proceed to a transformation fairly quickly as Gibson products are only stable for a few hours.
 
</div>
 
</div>
 +
 +
<div style='padding-top: 20px;'></div>
 +
 +
<div style = 'padding-left: 8%; padding-bottom: 10px;font-size: 25px' ><b>Additional Information</b></div>
 +
<div style='background: #808080; margin: 0px 8% 20px 8%; height:2px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
  
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Additional Information</b></div>
+
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b>Designing New 3G Parts</b></div>
 
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 
<div style='padding-top: 0px;'></div>
 
<div style='padding-top: 0px;'></div>
 
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
<h1>Designing New 3G Parts</h1>
+
To design a new 3G part, use Gene Block to design a new sequence of double stranded DNA. Include a 40 bp pad sequence on either end, along with a BsaI site and sticky ends appropriate for the part type (for more information on pad sequences, see <a href='https://2018.igem.org/Team:William_and_Mary/3G#PAD' style="color:green">3G Assembly</a>). This allows the new part to be cloned onto a William and Mary pad backbone.  
</div>
+
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
+
To design a new 3G part, use Gene Block to design a new sequence of double stranded DNA. Include a 40 bp pad sequence on either end, along with a BsaI site and sticky ends appropriate for the part type(for more information on pad sequences, see “In Our Project” (link to 3G page)). This allows the new part to be cloned onto a William and Mary pad backbone.  
+
 
</div>
 
</div>
 +
 
<div style='padding-top: 20px;'></div>
 
<div style='padding-top: 20px;'></div>
 +
 +
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b> Troubleshooting</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 
<div style = 'padding-right: 14%; padding-left: 14%; text-indent: 50px;line-height: 25px;'>
 +
In general, when 3G assembly fails, it will fail at the gel extraction phase. If correctly sized DNA is obtained from the gel, the Gibson reaction works very well. For circuits that fail to amplify at the PCR step, we recommend running an increased number of golden-gate cycles (100 or 30 for NEB and BsaI respectively). Additionally, use of longer (40 bp), full length UNS amplification primers may be helpful for amplification.
  
 
</div>
 
</div>
  
<table class=" unit 1" style="width:33.33%; float:right; margin-right:150px;">
+
 
  <center> <caption>Primers for Amplification of Transcriptional Units</caption> </center>
+
<div style='padding-top: 20px;'></div>
 +
<div style = 'padding-left: 14%; padding-bottom: 10px;font-size: 25px' ><b> Sequences</b></div>
 +
<div style='background: #808080; margin: 0px 14% 20px 14%; height:1px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
 +
 
 +
<!-- start table-->
 +
 
 +
<center>
 +
 
 +
<table style=''>
 +
<center> <caption>Oligo Adapter Sequences</caption> </center>
  
 
<tr>
 
<tr>
<th style='background-color: #65A686;column-width: 50px;'><center>UNS Amplification Primer</center></th>  
+
<th style='background-color: #65A686;column-width: 150px;'><center>Oligo Adapter</center></th>  
<th style='background-color: #65A686;column-width: 200px;'><center>Sequence</center></th>
+
<th style='background-color: #65A686;column-width: 150px;'><center>Sequence</center></th>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS1 Forward </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>pOSIP A Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CATTACTCGCATCCATTCTCAGGC</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCCCCGGGTACCGAGCTCGAATTCCGATCCCCAATTGGCGTC</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS3 Forward </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>pOSIP A Top</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>GCACTGAAGGTCCTCAATCG</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GACGCCAATTGGGGATCGGAATTCGAGCTCGGTACCCGGGGGAGAGAGACCGG</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS4 Forward </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>pOSIP E Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CTGACCTCCTGCCAGCAATAGT</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>AGGCGCCATGCATCTCGAGGCATGCCTGCAGCGGCCGCTAAAGCAGAGACCCC</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS5 Forward </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>pOSIP E Top</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>GAGCCAACTCCCTTTACAACCT</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGGGTCTCTGCTTTAGCGGCCGCTGCAGGCATGCCTCGAGATGCATGGCGCCT</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS6 Forward </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS1_A_Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CTCGTTCGCTGCCACCTAAGAA</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCGAGACGAGACGAGACAGCCTGAGAATGGATGCGAGTAATG</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS7 Forward</td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS1_A_Top</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CAAGACGCTGGCTCTGACATTT</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CATTACTCGCATCCATTCTCAGGCTGTCTCGTCTCGTCTCGGAGAGAGACCGG</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS3 Reverse</td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3_A Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CGACCTTGATGTTTCCAGTGCG</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCCGACCTTGATGTTTCCAGTGCGATTGAGGACCTTCAGTGC</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS4 Reverse </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3_A_Top</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>GACTTTGCGTGTTGTCTTACTAT</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GCACTGAAGGTCCTCAATCGCACTGGAAACATCAAGGTCGGGAGAGAGACCGG</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS5 Reverse </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3_E_Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>CTCTAACGGACTTGAGTGAGGTTG</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CGACCTTGATGTTTCCAGTGCGATTGAGGACCTTCAGTGCAAGCAGAGACCCC</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS6 Reverse</td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3_E_Top</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>GTATGTGACCGTAGAGTATTCTTAGGTGG</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGGGTCTCTGCTTGCACTGAAGGTCCTCAATCGCACTGGAAACATCAAGGTCG</td>
 
</tr>
 
</tr>
  
 
<tr>
 
<tr>
<td style='background-color: #A2CBAB;column-width: 50px; font-size: 15px;'>UNS10 Reverse </td>
+
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4_A_Bottom</td>
<td style='background-color: #96B69C;column-width: 200px; font-size: 15px;'>GGTGGAAGGGCTCGGAGTTG</td>
+
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCGACTTTGCGTGTTGTCTTACTATTGCTGGCAGGAGGTCAG</td>
 
</tr>
 
</tr>
  
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4_A_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTGACCTCCTGCCAGCAATAGTAAGACAACACGCAAAGTCGGAGAGAGACCGG</td>
 +
</tr>
  
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4_E_Bottom</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GACTTTGCGTGTTGTCTTACTATTGCTGGCAGGAGGTCAGAAGCAGAGACCCC</td>
 +
</tr>
  
<div style='padding-top: 40px;'></div>
+
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4_E_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGGGTCTCTGCTTCTGACCTCCTGCCAGCAATAGTAAGACAACACGCAAAGTC</td>
 +
</tr>
  
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5_A_Bottom</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCCTCTAACGGACTTGAGTGAGGTTGTAAAGGGAGTTGGCTC</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5_A_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GAGCCAACTCCCTTTACAACCTCACTCAAGTCCGTTAGAGGGAGAGAGACCGG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5_E_Bottom</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTCTAACGGACTTGAGTGAGGTTGTAAAGGGAGTTGGCTCAAGCAGAGACCCC</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5_E_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGGGTCTCTGCTTGAGCCAACTCCCTTTACAACCTCACTCAAGTCCGTTAGAG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS6_A_Bottom</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CCGGTCTCTCTCCGTATGTGACCGTAGAGTATTCTTAGGTGGCAGCGAACGAG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS6_A_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTCGTTCGCTGCCACCTAAGAATACTCTACGGTCACATACGGAGAGAGACCGG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS10_E_Bottom</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGTGGAAGGGCTCGGAGTTGTGGTAATCTATGTATCCTGGAAGCAGAGACCCC</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS10_E_Top</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGGGTCTCTGCTTCCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC</td>
 +
</tr>
 +
 +
</table>
 +
</center>
 +
 +
 +
<center>
 +
 +
<table  style=''>
 +
<center> <caption>Primers for Amplification of Transcriptional Units</caption> </center>
 +
 +
<tr>
 +
<th style='background-color: #65A686;column-width: 150px;'><center>UNS Amplification Primer</center></th>
 +
<th style='background-color: #65A686;column-width: 150px;'><center>Sequence</center></th>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS1 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CATTACTCGCATCCATTCTCAGGC</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GCACTGAAGGTCCTCAATCG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTGACCTCCTGCCAGCAATAGT</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GAGCCAACTCCCTTTACAACCT</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS6 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTCGTTCGCTGCCACCTAAGAA</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS7 Forward</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CAAGACGCTGGCTCTGACATTT</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS3 Reverse</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CGACCTTGATGTTTCCAGTGCG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS4 Reverse</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GACTTTGCGTGTTGTCTTACTAT</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS5 Reverse</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>CTCTAACGGACTTGAGTGAGGTTG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS6 Reverse</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GTATGTGACCGTAGAGTATTCTTAGGTGG</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>UNS10 Reverse</td>
 +
<td style='background-color: #96B69C;column-width: 150px; font-size: 15px;'>GGTGGAAGGGCTCGGAGTTG</td>
 +
</tr>
 +
 +
</table>
 +
</center>
 +
 +
<center><table  style=''>
 +
<center> <caption>Primers for Creation of UNS Backbones</caption> </center>
 +
 +
<tr>
 +
<th style='background-color: #65A686;column-width: 150px;'><center>Primer</center></th>
 +
<th style='background-color: #65A686;column-width: 150px;'><center>Sequence</center></th>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>Biobrick Suffix Fwd, UNS10 Overhang </td>
 +
<td style='background-color: #96B69C;column-width: 300px; font-size: 15px;'>CCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACCTACTAGTAGCGGCC</td>
 +
</tr>
 +
 +
<tr>
 +
<td style='background-color: #A2CBAB;column-width: 150px; font-size: 15px;'>Biobrick Prefix Rev, UNS1 Overhang</td>
 +
<td style='background-color: #96B69C;column-width: 300px; font-size: 15px;'>GAGACGAGACGAGACAGCCTGAGAATGGATGCGAGTAATGCTAGAAGCGGCC</td>
 +
</tr>
 +
 +
</table></center>
 
<!---References----->
 
<!---References----->
  
<div style = 'padding-left: 190px; padding-bottom: 10px;font-size: 25px' ><b>References</b></div>
+
<div class="references"><div style = 'padding-left: 8%; padding-bottom: 10px;font-size: 25px' ><b>References</b></div>
 +
<div style='background: #808080; margin: 0px 8% 20px 8%; height:2px;></div>
 +
<div style='padding-top: 0px;'></div>
 +
 
 +
<!--<div style = 'padding-left: 190px; padding-bottom: 10px;font-size: 25px' ><b>References</b></div>
  
 
<div style='background: #808080; margin: 0px 190px 20px 190px; height:1px;></div>
 
<div style='background: #808080; margin: 0px 190px 20px 190px; height:1px;></div>
Line 262: Line 503:
 
<div style='padding-top: 0px;'></div>
 
<div style='padding-top: 0px;'></div>
  
<div style='padding-top: 10px;'></div>
+
<div style='padding-top: 10px;'></div>-->
  
 
<div style = 'padding-right: 190px; padding-left: 190px; text-indent: 0px;line-height: 25px;' >[1] Single Day Construction of Multigene Circuits with 3G Assembly
 
<div style = 'padding-right: 190px; padding-left: 190px; text-indent: 0px;line-height: 25px;' >[1] Single Day Construction of Multigene Circuits with 3G Assembly
Line 268: Line 509:
 
</div>
 
</div>
  
<div style='padding-top: 15px;'></div>
+
<div style='padding-top: 15px;'></div></div>
 
+
 
+
 
+
 
+
 
+
  
 
</body>
 
</body>

Latest revision as of 23:49, 17 October 2018

Page Title

3G Assembly Protocols

Overview
3G assembly is a new and cutting edge hybrid method of DNA assembly first described in 2018 by A. D. Halleran, A. Swaminathan and R. M, Murray [1] which combines Golden Gate and Gibson assembly techniques to allow for modular assembly of multi-part circuits in a single day. In this method circuits are composed of modular transcriptional units which are constructed using Golden Gate Assembly. These transcriptional units are amplified with PCR, purified via gel extraction, then combined into a circuit using Gibson Assembly.
Figure 1: Overview of 3G workflow
Design
A circuit is composed of transcriptional units. Each transcriptional unit consists of a promoter, a 5’ untranslated region (UTR), a coding sequence (CDS), and a terminator in that order. Each of these four parts have distinct sticky ends according to the Cidar Modular Cloning System, which can be seen in the image below:
Figure 2: Schematic of MoClo Sticky Ends of promoters, 5' UTRs, CDSs and terminators
During the Golden Gate stage, the restriction enzyme BsaI cuts inside of its recognition site to reveal each part’s sticky ends so that they can be ligated together in the correct order. In addition, unique nucleotide sequences (UNS) are attached at the 5’ and 3’ end of the transcriptional unit using oligo adapters. The UNS on the 5’ end must have an A sticky end so that it can attach to the promoter, and the UNS on the 3’ end must have an E sticky end to attach to the terminator.
There are a variety of UNS sequences that can be used. In order for the transcriptional units to attach to the backbone in the Gibson stage, the first unit to go on the circuit must begin with UNS 1, and the last unit on the circuit must end with UNS 10. When creating transcriptional units that are intended to end up on a circuit together, it is important to ensure that their UNSs overlap. For instance, if the first unit is flanked by UNS 1 and UNS 3, the second must be flanked with UNS 3 and UNS 10.
In the next step, transcriptional units are amplified with PCR. The forward primer will anneal to the 5’ UNS and the reverse primer will anneal to the 3’ UNS. The PCR products are then gel extracted.
In the Gibson stage, transcriptional units are attached to each other and to a backbone. The backbone must have UNS 1 and UNS 10 inside the BioBrick Prefix and Suffix in order for the transcriptional units to attach. As mentioned earlier, the UNSs on each transcriptional unit determine the order they end up in, as shown below. Up to six transcriptional units can be put on a backbone in 3G assembly.
Figure 3: Gibson stage of 3G: Transcriptional units attach to the backbone at UNS 1 and UNS 10 and to each other at overlapping UNS
Transcriptional units are either supplied from the iGEM registry or can be designed. They may need to be cloned on a backbone in order to increase volume. Oligo adapters are then added.
Protocol
Preparation of 50 nM Oligo Adapters (UNS)
Single stranded lyophilized oligos (see table in Additional Information) are resuspending in IDT duplex buffer to a concentration of 100 uM. Top and bottom oligos are combined in a 1:1 molar ratio in duplex buffer to a final concentration of 1µM and then annealed by heating to 98C for 1 minute and then cool to room temperature on the benchtop. 50 nM working stocks are created by a 1:20 dilution of the 1µM stock in NFW.
Preparation of UNS1/10 iGEM Backbones
The UNS1/10 iGEM backbones can be prepared by a standard PCR. To a 0.2 mL tube, add:
  • 1.25 µL primer BBa_K2680513
  • 1.25 µL primer BBa_K2680514
  • 9 µl NFW, 1 ul of a miniprep of either pSB1C3 or pSB3K3
  • 12.5 µl of Q5 2x Master Mix.
Program the thermocycler with standard PCR cycles with a 55 C annealing temperature and a 1 minute extension time for pSB1C3, or a 1 minute 30 second extension time for pSB3K3. Gel extract the PCR product.
Preparation of 30 nM 3G parts
Quantify the concentration of the miniprepped 3G part with a nanodrop, convert to molarity, then dilute to 30 nM in nuclease free water.
Golden Gate Assembly
To a 0.2 mL tube, add the following:
  • 0.5 µL promoter 30 nM miniprep stock
  • 0.5 µL 5’ UTR 30 nM miniprep stock
  • 0.5 µL CDS 30 nM miniprep stock
  • 0.5 µL terminator 30 nM miniprep stock
  • 0.5 µL 50 nM left UNS adapter
  • 0.5 uL 50 nM right UNS adapter
In addition, either add:
  • 0.5 µL 10x DNA ligase buffer
  • 0.25 µL BsaI
  • 0.25 µL T4 DNA Ligase
  • 1 µL NFW
OR
  • 0.5 µL Golden Gate Buffer
  • 0.25 µL NEB Golden Gate Master Mix
  • 1.25 µL NFW
Note: if performing multiple Golden Gate reactions, we recommend making a master mix with a slight upscale, then add 2 µL of the master mix to reaction.

Cycle the reaction in the thermocycler. For the Golden Gate Master Mix perform 30 cycles of incubating at 37 for 1 minute then incubating at 16 C for one minute. For the T4 ligase and BsaI, perform 9 cycles at 37C for 3 minutes followed by incubating at 16 C for 4 minutes. For both options, hold at 37 C for five minutes, then hold at 4 C. For information on creating multiple circuit variants at once, see parallel 3G Assembly.
PCR Amplification
Amplify the product with a 50 uL PCR as according to the PCR protocol. Add:
  • 1.5 µL Golden Gate assembly product
  • 18.5 µL NFW
  • 2.5 µL of the appropriate 10uM UNS_foward Primer (that will anneal to the UNS on the 5’ end of your transcriptional unit)
  • 2.5 µL 10 uM of the appropriate UNS_reverse primer (that will anneal to the UNS on the 3’ end of your transcriptional unit)
  • 25 µL 2x Hot Start Master Mix
Incubate reactions using the standard 2x Q5 Hot Start Master Mix protocol with 27 cycles, using 30 seconds per kilobase pair, and an annealing temperature of 64 C. Conduct a gel extraction on the PCR product. (Note that 3G often produces off target bands as well as an extremely bright on target band. This is normal, and is why gel extraction rather than PCR purification is recommended).
Gibson Assembly
Perform a 5 uL Gibson assembly using the purified transcriptional units and vectors. Add to a .2 mL tube:
  • .015 pmolar each fragment
  • .015 pmolar desired backbone
  • Add NFW to a total volume of 2.5 µL.
  • 2.5 ul 2X HiFi DNA Assembly master mix
Ensure the total fragment volume of the PCR product and backbone does not exceed 2.5 µl. Place tube in a thermocycler, run for 50 C for an hour, and hold at 4 C. Proceed to a transformation fairly quickly as Gibson products are only stable for a few hours.
Additional Information
Designing New 3G Parts
To design a new 3G part, use Gene Block to design a new sequence of double stranded DNA. Include a 40 bp pad sequence on either end, along with a BsaI site and sticky ends appropriate for the part type (for more information on pad sequences, see 3G Assembly). This allows the new part to be cloned onto a William and Mary pad backbone.
Troubleshooting
In general, when 3G assembly fails, it will fail at the gel extraction phase. If correctly sized DNA is obtained from the gel, the Gibson reaction works very well. For circuits that fail to amplify at the PCR step, we recommend running an increased number of golden-gate cycles (100 or 30 for NEB and BsaI respectively). Additionally, use of longer (40 bp), full length UNS amplification primers may be helpful for amplification.
Sequences
Oligo Adapter Sequences
Oligo Adapter
Sequence
pOSIP A Bottom CCGGTCTCTCTCCCCCGGGTACCGAGCTCGAATTCCGATCCCCAATTGGCGTC
pOSIP A Top GACGCCAATTGGGGATCGGAATTCGAGCTCGGTACCCGGGGGAGAGAGACCGG
pOSIP E Bottom AGGCGCCATGCATCTCGAGGCATGCCTGCAGCGGCCGCTAAAGCAGAGACCCC
pOSIP E Top GGGGTCTCTGCTTTAGCGGCCGCTGCAGGCATGCCTCGAGATGCATGGCGCCT
UNS1_A_Bottom CCGGTCTCTCTCCGAGACGAGACGAGACAGCCTGAGAATGGATGCGAGTAATG
UNS1_A_Top CATTACTCGCATCCATTCTCAGGCTGTCTCGTCTCGTCTCGGAGAGAGACCGG
UNS3_A Bottom CCGGTCTCTCTCCCGACCTTGATGTTTCCAGTGCGATTGAGGACCTTCAGTGC
UNS3_A_Top GCACTGAAGGTCCTCAATCGCACTGGAAACATCAAGGTCGGGAGAGAGACCGG
UNS3_E_Bottom CGACCTTGATGTTTCCAGTGCGATTGAGGACCTTCAGTGCAAGCAGAGACCCC
UNS3_E_Top GGGGTCTCTGCTTGCACTGAAGGTCCTCAATCGCACTGGAAACATCAAGGTCG
UNS4_A_Bottom CCGGTCTCTCTCCGACTTTGCGTGTTGTCTTACTATTGCTGGCAGGAGGTCAG
UNS4_A_Top CTGACCTCCTGCCAGCAATAGTAAGACAACACGCAAAGTCGGAGAGAGACCGG
UNS4_E_Bottom GACTTTGCGTGTTGTCTTACTATTGCTGGCAGGAGGTCAGAAGCAGAGACCCC
UNS4_E_Top GGGGTCTCTGCTTCTGACCTCCTGCCAGCAATAGTAAGACAACACGCAAAGTC
UNS5_A_Bottom CCGGTCTCTCTCCCTCTAACGGACTTGAGTGAGGTTGTAAAGGGAGTTGGCTC
UNS5_A_Top GAGCCAACTCCCTTTACAACCTCACTCAAGTCCGTTAGAGGGAGAGAGACCGG
UNS5_E_Bottom CTCTAACGGACTTGAGTGAGGTTGTAAAGGGAGTTGGCTCAAGCAGAGACCCC
UNS5_E_Top GGGGTCTCTGCTTGAGCCAACTCCCTTTACAACCTCACTCAAGTCCGTTAGAG
UNS6_A_Bottom CCGGTCTCTCTCCGTATGTGACCGTAGAGTATTCTTAGGTGGCAGCGAACGAG
UNS6_A_Top CTCGTTCGCTGCCACCTAAGAATACTCTACGGTCACATACGGAGAGAGACCGG
UNS10_E_Bottom GGTGGAAGGGCTCGGAGTTGTGGTAATCTATGTATCCTGGAAGCAGAGACCCC
UNS10_E_Top GGGGTCTCTGCTTCCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC
Primers for Amplification of Transcriptional Units
UNS Amplification Primer
Sequence
UNS1 Forward CATTACTCGCATCCATTCTCAGGC
UNS3 Forward GCACTGAAGGTCCTCAATCG
UNS4 Forward CTGACCTCCTGCCAGCAATAGT
UNS5 Forward GAGCCAACTCCCTTTACAACCT
UNS6 Forward CTCGTTCGCTGCCACCTAAGAA
UNS7 Forward CAAGACGCTGGCTCTGACATTT
UNS3 Reverse CGACCTTGATGTTTCCAGTGCG
UNS4 Reverse GACTTTGCGTGTTGTCTTACTAT
UNS5 Reverse CTCTAACGGACTTGAGTGAGGTTG
UNS6 Reverse GTATGTGACCGTAGAGTATTCTTAGGTGG
UNS10 Reverse GGTGGAAGGGCTCGGAGTTG
Primers for Creation of UNS Backbones
Primer
Sequence
Biobrick Suffix Fwd, UNS10 Overhang CCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACCTACTAGTAGCGGCC
Biobrick Prefix Rev, UNS1 Overhang GAGACGAGACGAGACAGCCTGAGAATGGATGCGAGTAATGCTAGAAGCGGCC
References
[1] Single Day Construction of Multigene Circuits with 3G Assembly Andrew D. Halleran, Anandh Swaminathan, and Richard M. Murray. ACS Synthetic Biology 2018 7 (5), 1477-1480. DOI: 10.1021/acssynbio.8b00060