Latest revision as of 00:53, 18 October 2018

NoteBook

Day 1, Monday 04/06

People In Lab: Amalia, Carla, Daniel, Jasmeen, Nina

Agenda:

LB media
LB + agar plates
Aliquoted autoclaved SOC
70% EtOH

Equipment used:

Autoclave
Bunsen burner

Protocol: iGEM protocols used for LB, LB+agar, SOC (altered to accommodate MgCl2·6H₂O because we didn't have anhydrous version, thus, for 1L solution, 2.17g was needed).

Next Steps:

Get MG1655ΔlacI cells from Christian and streak onto LB plate
Transform arg1 and pSB1C3+RFP (iGEM competence test plasmid) into DH10β
Make MG1655ΔlacI glycerol stocks
Make LB+CAM and LB+KAN plates

Day 2, Tuesday 05/06

People In Lab: Carla

Agenda:

KAN plates
CAM plates

Equipment used:

Autoclave
Bunsen burner

Protocol: iGEM protocol used for LB+agar.

Calculation for antibiotics to be added to LB media for plating

Chloramphenicol

C₁V₁= C₂V₂

C₁= stock concentration = 25mg/mL

C₂= working concentration = 25μg/mL

(25000μg/mL)(V₁) = (25μg/mL)(500mL)

V₁= 0.5mL

Kanamycin

C₁V₁= C₂V₂

C₁= stock concentration = 10mg/mL

C₂= working concentration = 50μg/mL

(10000μg/mL)(V₁) = (50μg/mL)(500mL)
V₁= 2.5mL

Next Steps:

Obtain overnight culture of MG1655ΔlacI in the morning left for us in the shaker in room 318

Day 3, Wednesday 06/06

People In Lab:Amalia, Carla, Daniel, Jasmeen, Monica, Nina, Tashi

Agenda:

Transform pET28a+arg1 and pSB1C3+RFP (iGEM competence test plasmid) into DH10β
Streak MG1655ΔlacI onto LB plate

Equipment used:

ThermoMixer
Bunsen Burner
37°C incubator in room 301

Protocol: iGEM protocols used for transformation.

Transformation

Transformation 1: pSB1C3+RFP(10pg/μL) in DH10β: 100μL plated on LB+CAM

Transformation 2: pSB1C3+RFP (10pg/μL)in DH10β: 100μL plated on LB+CAM

Transformation 3: pET28a+arg1 in DH10β: 100μL plated on LB+KAN

Transformation 4: pET28a+arg1 in DH10β: 100μL plated on LB+CAM

Negative control: 100μL DH10β plated on LB+CAM and LB+KAN

For each transformation, 50μL of cells and 2μL of plasmid, and 250μL of SOC were used

Next Steps:

Start interlab

Day 4, Thursday 07/06

People In Lab: Ahmed, Amalia, Daniel, Jasmeen, Nina

Agenda:

Observed transformed cells
- pSB1C3+RFP (10pg/μL) in DH10β
- pET28a+arg1 in DH10β
Observe streaked plate (LB+MG1655ΔlacI)
Make overnight cultures from transformed cells (37°C)
- 3 LB+CAM+DH10β+pSB1C3+RFP
- 3 LB+KAN+DH10β+pET28a+arg1
- 1 LB (negative control)
Transform interlab plasmids into DH5α
10 nuclease-free water aliquots

Equipment used:

Thermomixer
Bunsen Burner
37°C incubator in room 301

Protocol:Interlab protocols used for interlab transformation.

Interlab transformation

resuspend plasmids from plate 7 to a concentration of 200-300pg/μL
1μl plasmid used: 2B, 2D, 2F, 2H, 2J, 2L, 2N, 2P
50μL of competent cells used (DH5α)
50μL of cells plated on LB+CAM
2J was not incubated, has to be transformed again

Observations:

Picture of plates are shown below.

100μl transformation pET28a+arg1 in DH10β on LB+KAN

100μl transformation pSB1C3+RFP in DH10β on LB+KAN

100μl negative control (DH10β no plasmid) on LB+KAN and LB+CAM

Streaked MG1655ΔlacI on LB

Next Steps:

Miniprep pSB1C3+RFP and pET28a+arg1 from overnight cultures
Interlab calibration #1: OD₆₀₀Reference point - LUDOX Protocol

Day 5, Friday 08/06

People In Lab:Ahmed, Amalia, Daniel, Jasmeen, Nina, Tashi

Agenda:

Observe interlab transformations
Miniprep pSB1C3+RFP and pET28a+arg1 from overnight cultures
Nanodrop
Send miniprepped pSB1C3+RFP and pET28a+arg1 to Ranomics to add UNS2 and UNS3 to pSB1C3+RFP and fix illegal cut sites in pET28a+arg1
Interlab calibration #1: OD₆₀₀Reference point - LUDOX Protocol

Equipment used:

Thermomixer
Bunsen burner
37°C Incubator in room 301
Centrifuge
Nanodrop
Plate reader

Protocol: Protocol from miniprep kit used for miniprep. Interlab protocol used for Interlab calibration #1: OD₆₀₀Reference point - LUDOX Protocol.

Miniprep of pSB1C3+RFP and pET28a+arg1

10mL of each overnight culture used
60μL of nuclease-free water used for each elution

Sending miniprepped pSB1C3+RFP and pET28a+arg1 to Ranomics

(Concentration after nanodrop)(Volume sent) = (mass sent)

pSB1C3+RFP: (39.3ng/μL)(51μL) = 2004.3ng

pET28a+arg1: (142.0ng/μL)(21μL) = 2982ng

Observations:

Interlab Transformation of 2F, 2H, 2N on LB+CAM

Interlab Transformation of 2B, 2D, 2L, 2P on LB+CAM

Interlab calibration #1: OD₆₀₀Reference point - LUDOX Protocol absorbance values

*Refer to interlab page on wiki*

Next Steps:

Transform 2J plasmid into DH5α
Make LB+KAN+CAM plates
Make PBS (dilute from stock in fridge or make from scratch)
Transform pET28a+arg1and pSB1C3+RFP into MG1655ΔlacI
Interlab calibration #2: Particle Standard Curve - Microsphere Protocol

Day 1, Monday 11/06

People In Lab:Amalia, Carla, Daniel, Jasmeen, Nina, Tashi

Agenda:

Transform 2J interlab plasmid into DH5α and plate on LB+CAM
LB+CAM plates
Interlab calibration #2: Particle Standard Curve - Microsphere Protocol
Electroporate MG1655ΔlacI
Transform pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI
Make and autoclave PBS for interlab calibration #3
Autoclave double distilled water

Equipment used:

Autoclave
Bunsen burner
Plate reader
Thermomixer
37°C incubator in room 301
Electroporator

Protocol: iGEM protocols used for transformation, electroporation, LB+agar. Interlab protocol used for Interlab calibration #2: Particle Standard Curve - Microsphere Protocol.

Transformation of 2J plasmid

1μLof 2J plasmid used, 50μLof cells plated

Interlab calibration #2

200μLbead stock in wells A1, B1, C1, D1
100μLdouble distilled water in wells A2-A12, B2-B12, C2-C12, D2-D12
performed serial dilution by transferring 100μLeach time, until well A11, B11, C11, D11
used the plate reader to shake the plate at an amplitude of 3.5 for 7 seconds, and measure the absorbance at wavelength 600nm

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI

2μLof pSB1C3+RFP(10pg/μL)
1μLofpET28a+arg1
plated 100μLon LB+CAM+KAN
plated 200μLon LB+CAM+KAN
plated 300μLon LB+CAM+KAN
plated negative control (100μLof untransformed MG1655ΔlacI)

Next Steps:

Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol
Interlab cell measurement protocol

Day 2, Tuesday 12/06

People In Lab: Amalia, Carla, Daniel, Nina

Agenda:

Second attempt at pSB1C3+RFP and pET28a+arg1 double transformation in MG1655ΔlacI, testing for incompatibility
Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol
Make overnight cultures from interlab transformation plates

Equipment used:

Bunsen burner
Plate reader
Electroporator
Shaker in room 315
37°C incubator in room 301

Protocol: iGEM protocols used for transformation by electroporation. Interlab protocol used for for Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI (electroporation)

Hypothesis: If we get growth on the positive control, LB+KAN, and LB+CAM plates with transformed cells, but not the double antibiotic plate, we can say that either the plasmids are incompatible, or the double antibiotic plate concentration is too high.

1.5μLof RFP (50pg/μL)
1.5μLof pET28a+arg1
plated 150μLof transformed cells on LB+CAM+KAN
plated 100μLof transformed cells on LB+CAM
plated 100μLof transformed cells on LB+KAN
plated 10μLof untransformed cells on LB+KAN (negative control)
plated 10μLof untransformed cells on LB (positive control)

Interlab calibration #3

serial dilution was performed and the plate was read
shaken 5s at amplitude = 2
excitation = 485nm
emission = 525nm
optimal gain used = 75
read from bottom of plate
The graph obtained from this experiment indicated an error, will repeat tomorrow

Interlab transformation overnight cultures

16 tubes with 5mL of LB and 5μLCAM
2 colonies were taken from each of the 8 plates (2B, 2D, 2F, 2H, 2J, 2L, 2N, 2P)
tubes placed in the shaker overnight at 37° at 250rpm

Observations:

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI

no colonies on negative control plate
no colonies on 100μL, 200μL, or 300μLplates

100μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI (negative control) on LB+CAM+KAN

100μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

200μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

300μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

Potential reasons for results:

antibiotic concentration too high (50μL/mL KAN + 25μL/mL CAM)
MG1655ΔlacIcells may no longer be competent
left MG1655ΔlacIcells thawing in the ice for too long
electroporation might have failed
plasmids may not have been compatible
we could try sequential transformation (still have to consider antibiotic concentration of LB+KAN+CAM plate)

Next Steps:

Finish Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

Cell growth, sampling, assay (interlab cell measurement)

Day 3, Wednesday 13/06

People In Lab:Amalia, Carla, Daniel, Nina

Agenda:

Redo Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol
Autoclave glass bottles, beads, tips, eppendorf tubes
Reculture the overnight cultures from the interlab transformation

Equipment used:

Autoclave
Bunsen burner
Plate reader
37°C shaker in room 315

Protocol: Used interlab protocol for interlab calibration.

Second attempt at Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

serial dilution was performed and the plate was read
excitation = 485nm
emission = 525nm
optimal gain used = 90
read from bottom of plate

Reculturing the overnight cultures from the interlab transformation

16 tubes with 5mL of LB and 5μLCAM
100μLfrom each previous overnight culture placed in respective new tube (DH5α)
tubes slightly unscrewed and tape placed on lid for aeration in shaker
tubes placed in the shaker overnight at 37°C at 250rpm

Observations:

Second double transformation pSB1C3+RFP and pET28a+arg1in MG1655ΔlacI

LB+CAM+pSB1C3+RFP and pET28a+arg1
- sparsely populated pink colonies
- presence of some colonies
LB+KAN+pSB1C3+RFP and pET28a+arg1
- no visible colonies
LB+KAN+CAM+pSB1C3+RFP and pET28a+arg1
- no visible colonies
LB+KAN+nontrasformed cells (negative control)
- no visible colonies
LB+nontransformed cells (positive control)
- growth on entire plate

Second double transformation pSB1C3+RFP and pET28a+arg1 in MG1655ΔlacI

Potential reasons for these results:

colonies on LB+CAM+pSB1C3+RFP+pET28a+arg1) because the cells are still competent and were transformed with pSB1C3+RPF
no colonies on LB+KAN+pSB1C3+RFP and pET28a+arg1not because the cells are not competent, but rather the transformation (pET28a+arg1into MG1655ΔlacI) failed
no colonies on LB+KAN+CAM+pSB1C3+RFP+pET28a+arg1 because the backbones are not compatible
no growth on LB+KAN+non transformed cells (negative control) because there was no antibiotic resistance gene in the cells
we had growth on LB+non transformed cells (positive control) because the cells were viable and there was no selection in the plate against them
- pET28a = KAN resistant - incompatible with pSB1C3 by group check
- pSB1C3 = CAM resistant - higher copy number than pET28a

Next Steps:

Finish interlab cell measurement protocol

Day 4, Thursday 14/06

People In Lab:Ahmed, Amalia, Daniel, Monica, Nina, Tashi

Agenda:

Interlab cell measurement protocol
Autoclave P1000 tips
LB media
LB+CAM plates

Equipment used:

Autoclave
Plate reader
Shaker in autoclave room
Bunsen burner
37°C incubator in room 301

Protocol: iGEM protocols used for LB, LB+agar. Interlab protocols used for interlab OD and CFU measurements.

Observations:

Next Steps:

Count colonies on CFU cell measurement plates for interlab cell measurement protocol
Transform pET28a+arg1intoMG1655ΔlacI cells

Day 5, Friday 15/06

People In Lab:Ahmed, Amalia, Nina, Tashi

Agenda:

Check overnight plated cultures for interlab CFU count
Transformation of pET28a+arg1 into electrically competent MG1655ΔlacIcells

Observations:

Interlab CFU count

Miniscule colonies on some plates after ~11 hours of incubation at 37°C. Some plates did not have any colonies. Plates were put back in the incubator for a few more hours.

Equipment used:

37°C incubator in room 301
Shaker in room 315
Electroporator

Protocol: iGEM protocols used for transformation by electroporation.

Transformation of ARG1 in electrically competent MG1655ΔlacIcells

pET28a+arg1diluted from 39.3ng/mL to 1ng/mL
- 38.3μLnuclease free water + 1μLpET28a+arg1
transformed cells in cuvette placed in shaker at 37°C, 250rpm
3 plates
- 40μLof untransformed MG1655ΔlacIcells (negative control)
- 100μLof MG1655ΔlacItransformed with pET28a+arg1
- 200μLof MG1655ΔlacItransformed with pET28a+arg1

Next Steps:

Redo Calibration #2: Particle Standard Curve - Microsphere Protocol
Overnight culture of 2B (2 colonies) and 2D (2 colonies) in DH5α
If pET28a+arg1 transformation works
- 2 MG1655ΔlacI overnight cultures (LB+KAN+IPTG)
- 2 MG1655ΔlacI overnight cultures (LB+KAN)
- streak a single MG1655ΔlacIcolony on an LB+KAN plate

Day 1, Monday 18/06

People In Lab: Amalia, Daniel, Jasmeen, Nina, Tashi

Agenda:

LB+CAM plates
Overnight culture of 2B (2 colonies) and 2D (2 colonies) (DH5α) for interlab
2 overnight cultures of LB+KAN+MG1655ΔlacI+IPTG
2 overnight cultures of LB+KAN+MG1655ΔlacI
Streak plate pET28a+arg1 transformation on LB+KAN to get single colonies (MG1655ΔlacI)
Autoclave microcentrifuge tubes

Equipment used:

Autoclave
Bunsen burner
Shaker in room 315

Protocol: iGEM protocols used for LB+agar

Overnight cultures of colonies 2B+2D for interlab CFU

-4 LB+CAM tubes each with 5mL LB+5μL CAM

-2 colonies taken from 2B plate and inoculated

-2 colonies taken from 2D plate and inoculated

-all tubes placed in the shaker at 37°C at 250rpm

Serial dilution of IPTG

-dilution 1: 30μL of 1M IPTG stock in 10mL of LB = conc. 3mM

-10μL of dilution 1 in 10mL of LB = conc. 3μM

Overnight cultures of pET28a+arg1

-4 tubes

-2 with 5mL LB+IPTG+25μL KAN

-2 with 5mL LB+25μL KAN

-all tubes placed in the shaker at 37°C at 250rpm

Observations:

pET28a+arg1 transformation into MG1655ΔlacI

-No colonies on negative control plate or 100μL plate of transformed cells

-2 blobs on the 200μL plate of transformed cells

pET28a+arg1 transformation into MG1655ΔlacI negative control - 40μL untransformed cells

pET28a+arg1 transformation into MG1655ΔlacI 100μL transformed cells

pET28a+arg1 transformation into MG1655ΔlacI 200μL transformed cells

CFU colony count

		Colony 1			Colony 2
2B	dilution 3	210	201	224	134	0	300
	dilution 4	*	*	*	*	*	*
	dilution 5	*	*	*	*	*	*

2D	dilution 3	144	174	108	352	273	372
	dilution 4	31	16	33	20	1	11
	dilution 5	3	1	3	1	4	3

*plates were cracked because they were frozen

Next Steps:

Redo interlab CFU protocol
Let overnight cultures settle on bench (LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG) and (LB+KAN+MG1655ΔlacI+pET28a+arg1)
Centrifuge pET28a+arg1 overnight cultures at 350g for 4 hours (LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG) and (LB+KAN+MG1655ΔlacI+pET28a+arg1)
Streak out a single colony from the MG1655ΔlacI+pET28a+arg1 plate on an LB+KAN plate

Day 2, Tuesday 19/06

People In Lab: Amalia, Daniel, Nina, Tashi

Agenda:

Continue interlab CFU protocol (up until plating)
Centrifuge 1 overnight culture (LB+KAN+MG1655ΔlacI+IPTG) and 1 overnight culture (LB+KAN+MG1655ΔlacI) for 4 hours at 350g
Keep 1 overnight culture (LB+KAN+MG1655ΔlacI+IPTG) and 1 overnight culture (LB+KAN+MG1655ΔlacI) on bench and observe
Re-streak MG1655ΔlacI+pET28a+arg1 transformation on LB+KAN to get single colonies (was not incubated yesterday)
Make new overnight culture of MG1655ΔlacI+pET28a+arg1

Equipment used:

Bunsen burner
Plate reader
Shaker in autoclave room
Centrifuge in room 301
37°C incubator in room 301

Protocol: Interlab protocol used for CFU experiement

Overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1

-5mL LB+25μL KAN+incoulation from a blob from the LB+KAN+MG1655ΔlacI+pET28a+arg1 transformation plate

-tube placed in shaker at 37°C at 220rpm

Observations:

pET28a+arg1 induction

LB+KAN+MG1655ΔlacI+pET28a+arg1, LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG in centrifuge - cells pelleted at the bottom

-potential reason - too many gs

LB+KAN+MG1655ΔlacI+pET28a+arg1, LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG on bench - no separation

-potential reasons -arg1 not induced by IPTG?

-too hard flotation to see because there is no reporter

Centrifuged LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG (left )and LB+KAN+MG1655ΔlacI+pET28a+arg1 (right)

Next Steps:

LB media
LB+KAN plates
Dilute overnight culture to OD=0.3
Make IPTG dilution
Induce LB+KAN+MG1655ΔlacI+pET28a+arg1 culture with 3μM IPTG for 22 hours (2 tubes)
Make new LB+KAN+MG1655ΔlacI+pET28a+arg1 overnight culture for 22 hours (2 tubes)
Count colonies for interlab CFU
Streak out a single colony from the (MG1655ΔlacI) plate on an LB+KAN plate
Make protocol for growth curve for dry lab

Day 3, Wednesday 20/06

People In Lab: Amalia, Daniel, Jasmeen, Nina, Tashi

Agenda:

Make LB liquid media
Make LB+KAN plates
Count colonies for interlab CFU
Streak out a single colony from the MG1655ΔlacI+pET28a+arg1 plate on an LB+KAN plate
Induce LB+KAN+MG1655ΔlacI+pET28a+arg1 culture with 3μM IPTG for 22 hours (2 tubes)
Make new LB+KAN+MG1655ΔlacI+pET28a+arg1 overnight culture for 22 hours (2 tubes)

Equipment used:

Autoclave
Bunsen burner
Shaker in autoclave room
37°C incubator in room 301
Spectrophotomter

Protocol: iGEM protocols used for LB+agar, interlab protocol used for CFU experiement

IPTG dilution #1 in LB

C₁V₁ = C₂V₂

C₁= 1M

C₂= 3mM

V₂= 10mL

V₁= 30μL

= take 30ul of stock and add to 10mL LB+KAN

IPTG dilution #2 in LB

C₁V₁ = C₂V₂

C₁= 3mM

C₂= 3uM

V₂= 25mL

V₁= 25μL

= take 25ul of dilution #1 and add to LB+KAN

pET28a+arg1 overnight culture

1:8 dilution, measure OD, OD = 0.25

0.25x8 = 2

C₁V₁ = C₂V₂

C₁= 2

C₂= 0.3

V₂ = 25mL

V₁ = 3.75mL

Total volume = 25mL

25mL - 3.75mL = 21.25mL

-21.25mL LB + KAN + 3.75mL overnight culture

-21.25mL LB + KAN + IPTG + 3.75mL overnight culture

Abs₆₀₀ blank (LB+KAN+IPTG) = 0.00 (tared)

Abs₆₀₀ (LB+KAN+IPTG+ARG1) = 0.127

Both tubes placed in shaker at 37°C at 220 rpm (one with IPTG and one without)

Observations:

CFU colony count #2

		Colony 1			Colony 2
2B	dilution 3	180	138	40	77	78	91
	dilution 4	6	16	8	10	8	4
	dilution 5	2	3	2	1	0	1

2D	dilution 3	215	150	149	83	115	274
	dilution 4	45	28	28	30	14	28
	dilution 5	2	2	2	0	4	4

Colony forming unit calculation (using Dilution 3 data)

Calculated for Interlab Form IV

(# of colonies) x (Final Dilution Factor) = CFU/mL

Final Dilution Factor = 8 x 10⁴

	Colony 1	Colony 2	-		Colony 1	Colony 2
2B	8.64 x 10^6	6.16 x 10^6	-	2D	1.72 x 10^7	6.64 x 10^6
	1.104 x 10^7	6.24 x 10^6	-		1.2 x 10^7	9.20 x 10^6
	3.20 x10^6	7.28 x 10^6	-		1.192 x 10^7	2.192 x 10^7

MG1655ΔlacI+pET28a+arg1 streak to get single colonies

Next Steps:

LB+KAN plates
Make KAN dilutions
Order primers
Order blue protein

Day 4, Thursday 21/06

People In Lab: Amalia, Daniel, Jasmeen, Nina

Agenda:

Make LB + KAN plates
Make KAN dilutions
Make overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1 for dry lab growth curve
Order primers for pET28a+arg1
Order blue protein

Equipment used:

Bunsen burner
Shaker in room 315

Protocol:

KAN dilutions

(800μL of nuclease-free water+200μL 50mg/mL KAN = 1mL 10mg/mL KAN) x3

Overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1 for growth curve

-(15mL LB + 75μL KAN + incoulation from colony on newest MG1655ΔlacI+pET28a+arg1 plate) x3

-tube placed in shaker at 37°C at 220rpm

Observations:

MG1655ΔlacI+pET28a+arg1 streak to get clonal colonies

Next Steps:

LB+KAN plates
Make KAN dilutions
Do digest and run gel
Dry lab growth curve
Order amilCP

Day 5, Friday 22/06

People In Lab: Amalia, Nina, Daniel, Tashi

Agenda:

Make LB + KAN plates
Make KAN dilutions
LB+KAN+MG1655ΔlacI+pET28a+arg1 growth curve
Order amilCP

Equipment used:

Bunsen burner
Shaker in autoclave room
Plate reader
Autoclave

Protocol: iGEM protocols for LB+agar and KAN dilutions

KAN dilutions

-80mL of 10mg/mL were made

-50 microcentrifuge tubes were filled with 1mL each and 30mL remains in a falcon tube in the fridge

LB+KAN+MG1655ΔlacI+pET28a+arg1 growth curve

-1:8 dilution made from each overnight culture (175mL LB+KAN and 25mL culture in well)

-200μl LB+KAN pipetted in well (blank)

-measure OD₆₀₀

-subtract blank value, multiply by 8 to get original concentration (OD)

-dilute each overnight culture to get an OD of 0.1

-take OD again (0h timepoint)

-place the three replicates back in the shaker and measure again every hour (200μL)

Observations:

Volumes for LB+KAN+MG1655ΔlacI+pET28a+arg1 in growth curve cultures based on OD values of 1:8 dilutions-blank value multiplied by 8

Overnight culture 1 1:8 dilution OD without blank = 0.2209

Overnight culture 1 original OD = 1.3576

Replicate 1 LB+KAN = 23.158mL

Replicate 1 overnight culture = 1.841mL

Overnight culture 2 1:8 dilution OD without blank = 0.2167

Overnight culture 2 original OD = 1.324

Replicate 2 LB+KAN = 23.111mL

Replicate 2 overnight culture = 1.888mL

Overnight culture 3 1:8 dilution OD without blank = 0.2235

Overnight culture 3 original OD = 1.3784

Replicate 3 LB+KAN = 23.186mL

Replicate 3 overnight culture = 1.814mL

LB+KAN+MG1655ΔlacI+pET28a+arg1 in growth curve data

0	0.094	0.0942	0.1022	*0.0512
1	0.1808	0.1757	0.1713
2	0.255	0.2538	*0.4448
3	0.3391	0.3247	0.3332
4	0.3937	0.4075	0.4032
5	0.4539	0.4688	0.4326
6	0.4652	0.4797	0.4705

*Replicate 3 OD at 2h has an incorrect measurement. All 2h replicates were retested an hour later and they all had very similar values.

*All measurements shown already have the blank value subtracted from the raw value

Next Steps:

PCR pET28a+arg1 with new primers
Give Scott LB plate to streak with BL21
LB+AMP plates (for gibson positive control)
Order gibson
Order amilCP

Day 1, Monday 25/06

People In Lab: Daniel, Nina, Tashi

Agenda:

Make LB+AMP plates
Autocleave tips (p200)
Run practice PCR with pSB1C3
pSB1C3_UNS3_REV Primer
pSB1C3_UNS2_FWD Primer

Equipment used:

Autoclave
Thermocycler
Bunsen Burner

Protocol:

6 x 50μL reactions for amplifying pSB1C3

-Primers 2.5 ul * 6 = 15 ul * 2 (rev&fwd)

5x buffer (HF or GC) of Phusion ---> 10ul * 6 = 60ul

10mM of dNTPs ---> 1ul * 6 = 6ul

DMSO(100%) ---> 6*50*3% = 9ul

Phusion polymerase ---> 0.5*6 = 3ul

Nuclease free water ----> 300ul - (60ul + 9ul + 3ul + 30 ul + 0.07ul) = 197.93 ul (forgot to add 6ul dNTPs, solution more dilute)

pSB1c3 (142ng/ul)-----> 0.07ul (0.1ul used)

UNS3 _rev : CGACCTTGATGTTTCCAGTCCGATTGAGGACCTTCAGTGCCTCTAGAAGCGGCCGCG

uns2_FWD: GCTGGGAGTTCGTAGACGGAAACAAACGCAGAATCCAAGCTACTAGTAGCGGCCGCT

NEB temp: 72°C

LB+AMP plates:

Accoding to the protocol found in iGEM binder.

C₁= 50mg/μL

C₂=50ug/mL

V₂=500mL

V₁=0.5mL

Next steps:

Run practice PCR with protocol on thermocycler
Run gel for PCR product
Overnight culture for growth curve
Innoculation for growth curve (3x50mL falcon tubes)

Day 2, Tuesday 26/06

People In Lab: Amalia, Daniel, Nina, Jasmeen, Tashi

Agenda:

Run practice PCR with protocol on thermocycler
Run gel for PCR product
Overnight culture for growth curve
Innoculation for growth curve (3x50ml falcon tubes)

Equipment used:

Thermalcycler
Shaker
Electrophoresis machine
UV light for gel visualization

Protocol:

Used protocols from iGEM binder for casting and loading gel for gel electrophoresis. Used protocol from Phusion for PCR reaction.

Growth Curve

-add 25mL LB+KAN to 3 50mL falcon tubes

-run blank readings

-innoculate 3 tubes with clonal ARG1 plasmid in MG1655deltalacI and take OD readings every 30 mins for 10 hours

PCR mastermix

FWD PSB1C3 UNS2 505.7 ng/ul (nanodrop)

REV PSB1C3 UNS 3 894.1 ng/ul (nanodrop)

4 x 50ul reactions

-5x buffer 10ul x 4 = 40ul

-10mM dNTPs 1ul x 4 = 3ul (wrong)

-DMSO 1.5ul x 4 = 6ul

-phusion polymerase 0.5ul x 4 = 2ul

-RFP plasmid (142 ng/ul)

-dilute to 1ng/ul

-141ul UP water + 1ul RFP plasmid

-10ng x 4 = 10ul x 4 = 40ul

-FWD primer

-dilute to 1ng/ul

-504.7 UP water + 1ul primer

-2.5ul x 4 = 10ul

-REV primer

-dilute to 1ng/ul

-893.1 UP water + 1ul primer

-2.5ul x 4 = 10ul

-UP water 50ul x 4 - (40ul + 3ul + 6ul + 2ul + 40ul + 10ul + 10ul) = 89ul

-add 50ul of mastermix to 3 PCR tubes

Thermocycler settings

Hot start: 98 degrees

Denaturing: 98 degrees - 30s

Annealing: 98 degrees - 10s

72 degrees - 30s

72 degrees - 90s

Extension: 72 degrees - 10min

Hold: 4 degrees

Gel electrophoresis:

-nanodrop of product concentrations

PCR 1	600.2 ng/ul
PCR 2	341 ng/ul
PCR 3	398 ng/ul
PCR 4	403.4 ng/ul
PCR 5	313 ng/ul
PCR 1.1	269 ng/ul
PCR 1.2	280 ng/ul
PCR 1.3	323 ng/ul

PCR 1-5 = PCR products from 06/25/18

PCR 1.1-1.3 = PCR products from 06/26/18

-make dilutions usch that each PCR product has a concentration of 10ng/ul

-take 1ul of product and dilute in UP water

-eg. 1ul PCR 1 + 59ul UP water

-take 10ul of dilution and mix with 2ul loading dye

-load 12ul into wells

-V = 100

-A = 3.00 max

-W = 300 max

Observations:

DNA wells in gel

DNA ladder (0.1-10kb)

PCR 1

PCR 2

PCR 3

PCR 4

PCR 5

PCR 1.1

PCR 1.2

PCR 1.3

Next steps:

Finish dry lab growth curve for MG1655deltalacI in LB+KAN

Day 3, Wednesday 27/06

People In Lab: Amalia, Jasmeen, Nina, Tashi

Agenda:

Finish dry lab growth curve for MG1655deltalacI in LB+KAN
Run PCR with undiluted DNA
Autoclave beakers and jars
Streak out BL21 on an LB plate

Equipment used:

Autoclave
Electrophoresis machine
Gel doc in room 319
Bunsen burner

Protocol:

Used protocols from iGEM binder for casting and loading gel for gel electrophoresis.

Gel electrophoresis:

-load wells

-V = 100

-A = 3.00 max

-W = 300 max

Observations:

Dry lab growth curve for MG1655deltalacI in LB+KAN data

Blank	0.0465	0.0469	0.0475
0	0.0009	0	0.0012
0.5	0.0006	0.0002	-0.0006
1	0.0004	0.007	0
1.5	0.0015	-0.0017	-0.002
2	0.0008	0.005	0.0006
2.5	0.0026	-0.0024	0.0021
3	0.0125	0.0112	0.0073
3.5	0.0052	0.0099	0.0135
4	0.0182	0.0218	0.0301
4.5	0.0026	0.0475	0.0569
5	0.0675	0.1095	0.1241
5.5	0.105	0.1352	0.1496
6	0.1894	0.2295	0.2437
6.5	0.2181	0.2469	0.2506
7	0.2452	0.2818	0.2734
7.5	0.2649	0.3103	0.2781
8*	0.3018	0.3585	0.3656
8.5	0.3376	0.364	0.3548
9	0.358	0.3953	0.3864
9.5	0.3888	0.4057	0.404
10	0.4101	0.4305	0.4261
10.5	0.4494	0.4483	0.4571
11.5	0.468	0.4638	0.4764
23	0.8631	0.9021	0.963

*this measurement was taken after being out of the shaker for 30 mins

All measurements shown already have the blank value subtracted from the raw value

Gel electrophoresis for PCR

DNA ladder

PCR 1

PCR 2

PCR 3

PCR 4

PCR 5

PCR 1.1

PCR 1.2

PCR 1.3

PCR 1

PCR 1-5 = PCR products from 06/25/18

PCR 1.1-1.3 = PCR products from 06/26/18

Gel from PCR.jpg

Potential reasons for this result:

-PCR did not work

-the annealing temperature was wrong because it was calculated using the whole primer, instead of only the binding sequence

-the primers don't work

-the primers were suspended in water instead of TE buffer and could therefore be degraded

-nanodrop had inaccurate measurement for primer concentrations since they were old and small

-the primers were diluted to a concentration that would make them the limiting reagent for the reaction

Next steps:

Make LB
Overnight culture of BL21
PCR ARG1 + UNSs
Transform ARG1 into BL21

Day 4, Thursday 28/06

People In Lab: Ahmed, Amalia, Daniel, Jasmeen, Nina, Tashi

Agenda:

Make LB
PCR ARG1 + UNSs
Transform ARG1 into BL21
RFP digest

Equipment used:

Autoclave
Shaker in autoclave room
Benchtop incubator with shaker
Bunsen burner
Thermocycler
Electrophoresis machine
Gel doc

Protocol:

Used protocols from NEB for PCR and digestion

PCR mastermix

6 x 20ul reactions

UNS3 FWD

UNS2 REV

-5x HF buffer 4ul x 6 = 24ul

-10mM dNTPs 0.4ul x 6 = 2.4ul

-10uM FWD primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM FWD primer

-10uM REV primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM REV primer

-ARG 1 - dilute to 1ng/ul (original 39.3ng/ul)

-1ul ARG1 + 38.3ul UP water

-1ul x 6 = 6ul

-phusion DNA polymerase 0.2ul x 6 = 1.2ul

-DMSO 0.6ul x 6 = 3.6ul

-UP water 20ul x 6 - (24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul) = 89ul

-add 20ul of mastermix to 5 PCR tubes

-annealing temperature = 60 degrees

Thermocycler settings

Denaturing: 98 degrees - 30s

Annealing x30: 98 degrees - 10s

60 degrees - 30s

72 degrees - 363s

Extension: 72 degrees - 10min

Hold: 4 degrees

RFP digest

-1ul SPeI

-1ul EcoRI-HF

-7ul RFP plasmid

-5ul 10x cutsmart

-36ul UP water

Observations:

Gel for ARG1 PCR

DNA ladder 1kb

1

2

3

4

NTC

Table 5 - concentration of template is too high because the plasmid was not diluted, proper concentrations in gel represented by table 6

Gel for ARG 1 PCR with correct concentrations

DNA ladder 1kb

1.1

1.2

1.3

1.4

NTC

Digest

Next steps:

Run gels with a different ladder
Rerun gels with fresh TAE buffer
Do a PCR using the thermocycler in room 303 of PSB1C3 + RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)
Do a PCR using the thermocycler in room 403 of PSB1C3 + RFP and colony PCR primers
Make competent BL21 cells

Day 5, Friday 29/06

People In Lab: Ahmed, Amalia, Daniel, Nina, Tashi

Agenda:

Run gels with a different ladder
Rerun gels with fresh TAE buffer
Do a PCR using the thermocycler in room 303 of pSB1C3+RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)
Do a PCR using the thermocycler in room 403 of pSB1C3+RFP and colony PCR primers
Make competent BL21 cells
Autoclave baffel flasks

Equipment used:

Thermocycler in 303
Thermocycler in 403
Electrophoresis machine
Gel doc
Autoclave

Protocol:

PCR mastermix

pSB1C3+RFP with pSB1C3 colony primers

6 x 20ul reactions

-5x HF buffer 4ul x 6 = 24ul

-10mM dNTPs 0.4ul x 6 = 2.4ul

-10uM FWD primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM FWD primer

-10uM REV primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM REV primer

-RFP - dilute to 1ng/ul (original 142ng/ul)

-1ul RFP + 141ul UP water

-1ul x 6 = 6ul - 1 (NTC) = 5ul

-phusion DNA polymerase 0.2ul x 6 = 1.2ul

-DMSO 0.6ul x 6 = 3.6ul

-total in mastermix without water or template = 24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul = 43.2ul = 7.2ul per reaction

-for NTC: 7.2ul mastermix + 12.8ul UP water

-for remaining mastermix: 100ul - (43.2ul - 7.2ul NTC) - 5ul RFP = 59ul UP water

-add 20ul of mastermix to 5 PCR tubes

-temperature gradient:

1: 55 degrees

2: 59.3 degrees

3: 61 degrees

4: 65 degrees

NTC: 61 degrees

Thermocycler settings

Denaturing: 98 degrees - 30s

Annealing x30: 98 degrees - 10s

55-60 degrees - 30s

72 degrees - 363s

Extension: 72 degrees - 10min

Hold: 4 degrees

Observations:

Jun 29th 2018 Thermo Phusion Arg1 UNS2 FWD and UNS3 REV at 60C room 303.jpg

Jun 29th 2018 Thermo Phusion Arg1 (1ng) UNS2 FWD and UNS3 REV and digest at 60C room 303.jpg

Next steps:

Temperature gradient PCR without DMSO
Find Susie to do a biowaste disposal and autoclaving
Redesign primers for arg1

Day 1, Tuesday 03/07

People In Lab: Daniel, Tashi, Jasmeen

Agenda:

Growth curve for BL21 + Arg1 -> innoculation

Protocol:

Growth Curve(BL-21 cells + arg1 plasmid)
We started from innoculation.
For first 2 hours, we took the OD measurement every 30 minutes.
The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)
After 2 hours, we took the OD measuremetn every 15 minutes.
Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)

Results:

Growth Curve

	OD Measurements ( in triplicate)
Time (h)	1	2	3	log 1	log 2	log 3
0	0.0128	-0.0032	-0.009	-1.89279	/	/
0.5	0.0018	-0.0015	-0.0045	-2.74473	/	/
1	0.0013	-0.0015	-0.0024	-2.88606	/	/
1.5	-0.0002	-0.0013	-0.0075	/	/	/
2	0.0065	0.0004	-0.0073	-2.18709	-3.39794	/
2.25	0.0004	-0.002	-0.0073	-3.39794	/	/
2.5	0.0012	-0.0019	-0.0065	-2.92082	/	/
2.75	0.0007	-0.002	-0.008	-3.1549	/	/
3	0.0013	0.0006	-0.0078	-2.88606	-3.22185	/
3.25	0.0032	0.0052	-0.0069	-2.49485	-2.284	/
3.5	0.0026	0	-0.0061	-2.58503	/	/
3.75	0.0014	0	-0.0073	-2.85387	/	/
4	0.0011	0.0004	-0.0053	-2.95861	-3.39794	/
4.25	0.0056	0.0003	-0.0057	-2.25181	-3.52288	/
4.5	0.0076	0.0001	-0.0061	-2.11919	-4	/
4.75	0.0008	0.0009	-0.0073	-3.09691	-3.04576	/
5	0.0051	-0.0002	-0.0059	-2.29243	/	/
5.25	0.0049	0.0034	-0.0024	-2.3098	-2.46852	/
5.75	0.007	0.0088	0.0043	-2.1549	-2.05552	-2.36653
6.25	0.0156	0.0193	0.0187	-1.80688	-1.71444	-1.72816
6.75	0.0293	0.0403	0.0462	-1.53313	-1.39469	-1.33536
7.25	0.0681	0.0828	0.0946	-1.16685	-1.08197	-1.02411
7.75	0.1115	0.1328	0.1299	-0.95273	-0.8768	-0.88639
8.25	0.1629	0.2011	0.2112	-0.78808	-0.69659	-0.67531

image.png

Plan for future:

Redo growth curve and take OD measurements every 30 minutes.

Day 2, Wednesday 04/07

Individual Name: Daniel

People In Lab: Daniel, Tashi, Amalia, Jasmeen

Agenda:

Inoculate BL21+arg1 and BL21 cells
IPTG induction
Make liquid LB medium

Protocol:

Floatation Assay:
Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction
Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)
When OD₆₀₀ = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.

Day 3, Thursday 05/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

Agenda:

Floatation Assay
Pick the overnight induction sample and measure the OD
Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3
IPTG induction for newly inoculated culture
Growth curve with BL21+arg1 cells ( 30mins interval)

Protocol:

1. Floatation Assay:

Based on Shapiro Lab protocol
centrifuge the sample tubes under 350g for 4 hrs
3 sample tubes were set on the benchtop

Change plan for the floatation assay:

starting from 5 ml of overnight culture for 16hrs
1:100 dilution of the starting culture and let the OD reaches 0.5
Add IPTG to make conc. of 0.4mM(maybe 0.8mM for cell line we used) in the cell culture and start the induction for 22hrs under 30^oC.
After induction, centrifuge under 350g for 4 hrs

2. Growth curve:

starting from inoculation
the cell was grown in shaker( 220RPM & 37^oC)
Take the OD every 30 mins ( add 200ul to the plate reader)

Results:

Flotation observation:

BL21+arg1 Benchtop.jpg

BL21+IPTG Benchtop.jpg

BL21+arg1+IPTG Benchtop.jpg: Floating tissue observed

BL21+arg1 centrifuged.jpg

BL21 + IPTG Centrifuged.jpg: Floating tissue observed why？

BL21+arg1+IPTG centrifuged.jpg: Floating tissue observed

Growth Curve:

0-11 hrs

image.png

14.5-25 hrs

image.png

Day 4, Friday 06/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

Agenda:

Streak the plate of BL-21 non-transformed cell onto LB only plate
Run PCR with Phusion
Re-design the Arg1-UNS2&uns3 primers
Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve

Protocol:

PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56⁰C
HF buffer 5X 8ul
10mM dNTPs 0.8ul
10um FWD primer 2ul
10um REV primer 2ul
1ng/ul Arg1 2ul
phusion DNA polyemrase 0.4ul

Results:

Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg: no band observed

Day 1, Tuesday 03/07

People In Lab: Daniel, Tashi, Jasmeen

Agenda:

Growth curve for BL21 + Arg1 -> innoculation

Protocol:

Growth Curve(BL-21 cells + arg1 plasmid)
We started from innoculation.
For first 2 hours, we took the OD measurement every 30 minutes.
The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)
After 2 hours, we took the OD measuremetn every 15 minutes.
Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)

Results:

Growth Curve

	OD Measurements ( in triplicate)
Time (h)	1	2	3	log 1	log 2	log 3
0	0.0128	-0.0032	-0.009	-1.89279	/	/
0.5	0.0018	-0.0015	-0.0045	-2.74473	/	/
1	0.0013	-0.0015	-0.0024	-2.88606	/	/
1.5	-0.0002	-0.0013	-0.0075	/	/	/
2	0.0065	0.0004	-0.0073	-2.18709	-3.39794	/
2.25	0.0004	-0.002	-0.0073	-3.39794	/	/
2.5	0.0012	-0.0019	-0.0065	-2.92082	/	/
2.75	0.0007	-0.002	-0.008	-3.1549	/	/
3	0.0013	0.0006	-0.0078	-2.88606	-3.22185	/
3.25	0.0032	0.0052	-0.0069	-2.49485	-2.284	/
3.5	0.0026	0	-0.0061	-2.58503	/	/
3.75	0.0014	0	-0.0073	-2.85387	/	/
4	0.0011	0.0004	-0.0053	-2.95861	-3.39794	/
4.25	0.0056	0.0003	-0.0057	-2.25181	-3.52288	/
4.5	0.0076	0.0001	-0.0061	-2.11919	-4	/
4.75	0.0008	0.0009	-0.0073	-3.09691	-3.04576	/
5	0.0051	-0.0002	-0.0059	-2.29243	/	/
5.25	0.0049	0.0034	-0.0024	-2.3098	-2.46852	/
5.75	0.007	0.0088	0.0043	-2.1549	-2.05552	-2.36653
6.25	0.0156	0.0193	0.0187	-1.80688	-1.71444	-1.72816
6.75	0.0293	0.0403	0.0462	-1.53313	-1.39469	-1.33536
7.25	0.0681	0.0828	0.0946	-1.16685	-1.08197	-1.02411
7.75	0.1115	0.1328	0.1299	-0.95273	-0.8768	-0.88639
8.25	0.1629	0.2011	0.2112	-0.78808	-0.69659	-0.67531

image.png

Plan for future:

Redo growth curve and take OD measurements every 30 minutes.

Day 2, Wednesday 04/07

Individual Name: Daniel

People In Lab: Daniel, Tashi, Amalia, Jasmeen

Agenda:

Inoculate BL21+arg1 and BL21 cells
IPTG induction
Make liquid LB medium

Protocol:

Floatation Assay:
Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction
Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)
When OD₆₀₀ = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.

Day 3, Thursday 05/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

Agenda:

Floatation Assay
Pick the overnight induction sample and measure the OD
Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3
IPTG induction for newly inoculated culture
Growth curve with BL21+arg1 cells ( 30mins interval)

Protocol:

1. Floatation Assay:

Based on Shapiro Lab protocol
centrifuge the sample tubes under 350g for 4 hrs
3 sample tubes were set on the benchtop

Change plan for the floatation assay:

starting from 5 ml of overnight culture for 16hrs
1:100 dilution of the starting culture and let the OD reaches 0.5
Add IPTG to make conc. of 0.4mM(maybe 0.8mM for cell line we used) in the cell culture and start the induction for 22hrs under 30^oC.
After induction, centrifuge under 350g for 4 hrs

2. Growth curve:

starting from inoculation
the cell was grown in shaker( 220RPM & 37^oC)
Take the OD every 30 mins ( add 200ul to the plate reader)

Results:

Flotation observation:

BL21+arg1 Benchtop.jpg

BL21+IPTG Benchtop.jpg

BL21+arg1+IPTG Benchtop.jpg: Floating tissue observed

BL21+arg1 centrifuged.jpg

BL21 + IPTG Centrifuged.jpg: Floating tissue observed why？

BL21+arg1+IPTG centrifuged.jpg: Floating tissue observed

Growth Curve:

0-11 hrs

image.png

14.5-25 hrs

image.png

Day 4, Friday 06/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

Agenda:

Streak the plate of BL-21 non-transformed cell onto LB only plate
Run PCR with Phusion
Re-design the Arg1-UNS2&uns3 primers
Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve

Protocol:

PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56⁰C
HF buffer 5X 8ul
10mM dNTPs 0.8ul
10um FWD primer 2ul
10um REV primer 2ul
1ng/ul Arg1 2ul
phusion DNA polyemrase 0.4ul

Results:

Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg: no band observed

Day 1, Monday 16/07

People In Lab: Daniel, Nina, Tashi, Jasmeen

Agenda:

Making AMP stock solution
Make LB+ AMP plates
Overnight cultures of BL21 and BL21+ Arg1

Running very low on AMP powder

Day 2, Tuesday 17/07

People In Lab: Daniel, Nina, Tashi, Jasmeen

Agenda:

PCR of ARG1 plasmid using new IDT primers (UNS3 REV & UNS 2 FWD)
1:100 dilution BL21 +ARG 1 in baffle flask, BL21 in baffle flask

Protocol:

1. ARG1 new primer gradient PCR [64.5°C-67°C (extra rxn at 66°C)]:

7 RXNs 20ul each (One without a template)
annealing temp: 66⁰C
Reagent used:
Q5 Buffer (4μl x 7) 28ul
10mM FWD primer (1μ x 7) 7ul
10mM REV Primer (1μ x 7) 7ul
10mM dNTPs (0.4μl x 7) 2.8ul
Q5 ploymerase (0.2μl x 7) 1.4ul
1μg/μl Template DNA (6μ x 6) 6ul
Nuc Water Total mix with template for each rxn = 7.6μl
(20μl each rxn - 7.6μl = 12.5μl ) x 6 = 74.4ul H20 for mastermix
Total mix without template for each rxn = 6.6μl
20μl each rxn - 6.6μl = 13.5μl H2O for NTC

2. OD readings of BL21+ARG1 and BL21 for induction.

1ml was taken out of each culture every hour and placed in a cuvette
OD was measured using a spectrophotometer

3. Cultures were induced with IPTG at 2:40pm. replicate 1 of BL21+ARG1 was induced with 0.4mM of IPTG. Replicate 2 of BL21+ARG1 was induced with 0.8mM IPTG. BL21 cells were not induced with IPTG.

Results

1. ARG1 PCR with new primers results

37291721_2649158358642891_3010098950041501696_n.jpg

2. OD readings

Time	BL21+ Arg1 rep1	BL21+Arg2 rep2	BL21 rep1
1:16pm	0.086	0.097	0.323
2:30pm	0.353	0.359	1.081

Day 3, Wednesday 18/07

People In Lab: Amalia, Nina, Tashi

Agenda

Dpn1 digest of PCR1 product
PCR purification of PCR1 products
Nanodrop of PCR1 products after digest and purification
Overnight culture LB+BL21
Overnight culture of DH10B Arg1 and pSB1C3
place tubes in centrifuge 1hr

Dpn1 Digest

We have 10ul of PCR product per tube [4 tubes]

8ul of PCR product
1 ul of Dpn1
1 ul of cutsmart (10x)

10 ul of rxn (total)

PCR Purification (16,000 g/ 13,000 rpm)

30 ul sample
2:1 ratio binding buffer sample = 60ul
Load sample onto column
spin 1 min and discard flow through
reinsert column, add 200ul repeat DNA wash buffer
Transfer column to 1.5ml centrifuge tube
add 6ul nuclease free water
wait 1 min, spin 1 min

Completed nanodrop of 1ul of PCR purified product

concentration: 100.1 ug/ul

Day 4, Thursday 19/07

People In Lab: Amalia, Tashi, Ahmed, Daniel, Jasmeen

Agenda

PCR on new primers Arg1+UNS2FWD&UNS3REV (anneailing temp 66°C)
Nanodrop
Purification of PCR products
PCR product digest
Cell competency for BL21
Gibson assembly (blue protein and Arg1+UNS1&UNS3
Miniprep: Arg1+cor, RFP + UNS
Transform gibson into DH5⍺ cell from the kit
transform RFP from competency cell kit into BL21 cells

Protocols

PCR Calculation (7 reactions planned) 50 ul

Master Mix for 8 reactions
Reagent used:
Q5 master mix (25μl x 8) 200ul
10mM FWD primer (2.5μl x 7) 20ul
10mM REV Primer (2.5μl x 7) 20ul
1μg/μl Template DNA (2.5μl x 7) 17.5ul
Nuc Water Total mix with template for each rxn = 17.5μl

20μl for NTC

OD readings 1:100 dilution of BL21 for competency

Time	BL21 rep1	BL21 rep2
12:13pm	0.132	0.133
12.45pm	0.279	0.279
1:08pm	0.459	0.466

Note: Competency protocol was started after the last OD reading

Nanodrop ARG1 cor and RFP+UNS

Plasmid	Conc (ng/ul)
ARG1 cor	64.7
RFP+UNS	85.3

PCR gel for ARG1 and UNS (primers UNS2FWD, UNS3REV)

1kb+ NEB ladder

1

2

3

4

5

6

NTC

Gel result

image.png

DPN1 digest protocol

For a 10μl rxn x 2 = 20μl
16μl PCR product (well #1 ARG1 with UNS2FWD UNS3 primers)
2μl cutsmart buffer
2μl DPNI

DNA cleanup

2:1 ratio binding buffer :Digest product
40μl buffer:20μl digest product
For elution step use 20μl nuclease free water

Nanodrop ARG1+UNS after cleanup

Plasmid	conc(ng/μl)	260/280	260/230
ARG1+UNS	75.4	1.96	1.65

Gibson calculations (note limit for DNA in gibson rxn=0.2 picomoles)

ARG1+UNS

DNA length=12209bp

picomoles we want= 0.0667pmol

DNA Mass we had according to NEB calculator= 503.2ng

503.2ng/75.4ng/μl= 6.67μl --> ARG1+UNS added to gibson rxn

Blue protein (K=BBa_K592009)

DNA length= 764bp

picomoles we want= 0.1333333pmol

DNA mass we had according to NEB calculator=62.95ng

Note: the blue protein was resuspended in 50μl of nuclease free water for a final concentration of 20ng/μl

62.95ng/20ng/μl=3.15μl--> blue protein added to gibson

Transformation of gibson products

Gibson positive control (plated 100μl transformed DH5a (20μl of DH5a cells + 2 μl positive control gibson) onto AMP plate)

Gibson positive control transformation (plated 100μl transormed DH5a (20μl DH5a cells + positive control plasmid) onto AMP plate)

Gibson products (plated 50μl, 100μl, 200μ transformed DH5a (50μl DH5a cells + 2μl of gibson product) onto KAN plates)

Tranformation of RFP plasmid from competency cell kit

plated 100μl of transformed BL21 cells (100μl BL21 cells + 10pg, 50pg, 100pg RFP plasmid) onto CAM plates

Day 5, Friday 20/07

People In Lab: Amalia, Tashi, Ahmed, Nina

Agenda

Check Gibson and Bl21 competency plates
re-transform Gibson positive controls and gibson products

Results from Gibson

Both positive control plates (transformation control and gibson control) have colonies

None of the gibson product plates have colonies

image.png: Gibson plates: top left is positive control for transformation, top right is positive control for gibson, bottom 3 plates are plates with our gibson product transformation. Note the fact that only positive controls have colonies.

Troubleshooting

transformation was repeated

6 KAM plates were plated each with 200μl of transformed DH5a cells (50μl of DH5a cells transformed with 2μl of gibson product)

2 positive control plates: positive control for transformation (20μl of DH5a cells transformed with 2μl positive control plasmid)

positive control for gibson (20μl of DH5a cells transformed with 2μl of positive control gibson)

Results competency plates

plate plated with 50pg of plasmid grew 4 colonies

plate plated with 100pg of plasmid grew 3 colonies

plate plated with 10pg of plasmids did not grow colonies

image.png: 10pg

image.png: 50pg

image.png: 100pg

Note: these photos were taken after 4 days of plating but small colonies were observed after incubation overnight

@@ Line 2: / Line 2: @@
 <html>
+<style>
+.page-section {
+	/*height: 480px;*/
+	width: 60%;
+	margin-left: 25%;
+	margin-top: 0px;
+	padding: 3em;
+        padding-top: 0px;
+        padding-bottom: 0px;
+	background: linear-gradient(45deg, #ffffff 10%, #ffffff 90%);
+	color: white;
+	box-shadow: 0px 3px 10px 0px rgba(0, 0, 0, 0.5);
+}
+</style>
 <body>
 	<div style="margin-top: -7px;">
 		<div class="backgroundTertiaryHandler">
-			<nav class="navigation" id="mainNav">
+      <div id="scroller-anchor"></div>
+      <nav class="navigation" id="mainNav" style="border-style: solid;">
 				<a class="navigation__link" href="#1">Week 1</a>
 				<a class="navigation__link" href="#2">Week 2</a>
 				<a class="navigation__link" href="#3">Week 3</a>
+                                <a class="navigation__link" href="#4">Week 4</a>
+                                <a class="navigation__link" href="#5">Week 5</a>
+                                <a class="navigation__link" href="#6">Week 6</a>
+                                <a class="navigation__link" href="#7">Week 7</a>
+                                <a class="navigation__link" href="#8">Week 8</a>
+                                <a class="navigation__link" href="#9">Week 9</a>
+                                <a class="navigation__link" href="#10">Week 10</a>
+                                <a class="navigation__link" href="#11">Week 11</a>
+                                <a class="navigation__link" href="#12">Week 12</a>
+                                <a class="navigation__link" href="#13">Week 13</a>
+                                <a class="navigation__link" href="#14">Week 14</a>
+                                <a class="navigation__link" href="#15">Week 15</a>
+                                <a class="navigation__link" href="#16">Week 16</a>
+                                <a class="navigation__link" href="#17">Week 17</a>
+                                <a class="navigation__link" href="#18">Week 18</a>
+                                <a class="navigation__link" href="#19">Week 19</a>
+                                <a class="navigation__link" href="#20">Week 20</a>
 			</nav>
@@ Line 1,069: / Line 1,101: @@
 			<div class="page-section" id="3">
-				<button class="accordion">Week 3 NOT DONE</button>
+				<button class="accordion">Week 3</button>
 				<div class="panel">
-					<p>Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat.</p>
+					<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><span style="text-decoration: underline; font-size: 14pt;"><strong><span style="font-family: 'Times New Roman', serif;">Day 1, Monday 18/06</span></strong></span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Daniel, Jasmeen, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+CAM plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight culture of 2B (2 colonies) and 2D (2 colonies) <span style="background: white;">(DH5&alpha;) for interlab</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">2 overnight cultures of LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+IPTG</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">2 overnight cultures of </span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Streak plate <span style="background: white;">pET28a+</span><em>arg1</em> transformation on LB+KAN to get single colonies <span style="background: white;">(MG1655&Delta;</span><em>lacI</em><span style="background: white;">)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave microcentrifuge tubes</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Shaker in room 315</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol: </span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">iGEM protocols used for LB+agar</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight cultures of colonies 2B+2D for interlab CFU</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-4 LB+CAM tubes each with 5mL LB+5<span style="background: white;">&mu;L</span> CAM</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2 colonies taken from 2B plate and inoculated</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2 colonies taken from 2D plate and inoculated</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-all tubes placed in the shaker at 37&deg;C at 250rpm</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Serial dilution of IPTG</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-dilution 1: 30<span style="background: white;">&mu;L</span> of 1M IPTG stock in 10mL of LB = conc. 3mM</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10<span style="background: white;">&mu;L</span> of dilution 1 in 10mL of LB = conc. 3<span style="background: white;">&mu;</span>M</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight cultures of <span style="background: white;">pET28a+</span><em>arg1</em></span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-4 tubes</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2 with 5mL LB+IPTG+25<span style="background: white;">&mu;L</span> KAN</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2 with 5mL LB+25<span style="background: white;">&mu;L</span> KAN</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">-all tubes placed in the shaker at 37&deg;C at 250rpm</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">pET28a+</span></u><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">arg1</span></u></em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> transformation into <span style="background: white;">MG1655&Delta;</span><em>lacI</em></span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-No colonies on negative control plate or 100<span style="background: white;">&mu;L</span> plate of transformed cells</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2 blobs on the 200<span style="background: white;">&mu;L</span> plate of transformed cells</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">pET28a+arg1 transformation into MG1655&Delta;lacI negative control - 40&mu;L untransformed cells</span></strong><image src="https://static.igem.org/mediawiki/2018/6/65/T--Toronto--_Negative_control_-_40ul_untransformed_cells.jpg" height="350" width="350"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">pET28a+arg1 transformation into MG1655&Delta;lacI 100&mu;L transformed cells</span></strong><image src="https://static.igem.org/mediawiki/2018/9/9e/T--Toronto--_100ul_transformed_cells.jpg", height="350" width="350"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">pET28a+arg1 transformation into MG1655&Delta;lacI 200&mu;L transformed cells</span></strong><image src="https://static.igem.org/mediawiki/2018/f/fd/T--Toronto--_200ul_transformed_cells.jpg", height="350" width="350"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">CFU colony count</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 2</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: right; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2B</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">210</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">201</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">224</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">134</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">300</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: right; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2D</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">144</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">174</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">108</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">352</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">273</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">372</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">31</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">16</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">33</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">20</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">11</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">*plates were cracked because they were frozen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next Steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Redo interlab CFU protocol</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Let overnight cultures settle on bench (LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em>+IPTG) and (LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;">)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Centrifuge <span style="background: white;">pET28a+</span><em>arg1</em> overnight cultures at 350g for 4 hours (LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em>+IPTG)<span style="background: white;"> and </span>(LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;">)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Streak out a single colony from the <span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> plate<span style="background: white;"> on an LB+KAN plate</span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="text-decoration: underline; font-size: 14pt;"><strong><span style="font-family: 'Times New Roman', serif;">Day 2, Tuesday 19/06</span></strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Daniel, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Continue interlab CFU protocol (up until plating)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Centrifuge 1 overnight culture (LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+IPTG) and 1 <span style="background: white;">overnight culture (LB+KAN+MG1655&Delta;</span><em>lacI</em><span style="background: white;">) for 4 hours at 350g</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Keep 1 overnight culture (LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">+IPTG) and 1 overnight culture (LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">) on bench and observe</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Re-streak <span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> transformation on LB+KAN to get single colonies<span style="background: white;"> (was not incubated yesterday)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make new overnight culture of <span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Plate reader</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Shaker in autoclave room </span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Centrifuge in room 301</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">37&deg;C incubator in room 301</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol: </span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Interlab protocol used for CFU experiement</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight culture of <span style="background: white;">LB+KAN+MG1655&Delta;</span><em>lacI</em>+pET28a+<em>arg1</em></span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-5mL LB+25<span style="background: white;">&mu;L</span> KAN+incoulation from a blob from the <span style="background: white;">LB+KAN+MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> transformation plate</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-tube placed in shaker at 37&deg;C at 220rpm</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">pET28a+</span></u><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">arg1</span></u></em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> induction</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em>, LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em>+IPTG in centrifuge - cells pelleted at the bottom</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-potential reason - too many gs</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;">, LB+KAN+MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;">+IPTG on bench - no separation</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">-potential reasons -</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">arg1</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;"> not induced by IPTG?</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">-too hard flotation to see because there is no reporter</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Centrifuged LB+KAN+MG1655&Delta;lacI+pET28a+arg1+IPTG (left )and LB+KAN+MG1655&Delta;lacI+pET28a+arg1 (right)</span></strong><br/><image src="https://static.igem.org/mediawiki/2018/3/35/T--Toronto--_Centrifuged_IPTG_induced_Arg1_Arg1.jpg" height="350" width="350" style="transform:rotate(90deg);"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next Steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB media</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Dilute overnight culture to OD=0.3</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make IPTG dilution</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Induce LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;"> culture with 3&mu;M IPTG for 22 hours (2 tubes)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make new <span style="background: white;">LB+KAN+MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> overnight culture for 22 hours (2 tubes)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Count colonies for interlab CFU</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Streak out a single colony from the <span style="background: white;">(MG1655&Delta;</span><em>lacI</em><span style="background: white;">) plate on an LB+KAN plate</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make protocol for growth curve for dry lab</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><span style="text-decoration: underline; font-size: 14pt;"><strong><span style="font-family: 'Times New Roman', serif;">Day 3, Wednesday 20/06</span></strong></span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Daniel, Jasmeen, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make LB liquid media</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make LB+KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Count colonies for interlab CFU</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Streak out a single colony from the MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;"> plate on an LB+KAN plate</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Induce LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;"> culture with 3&mu;M IPTG for 22 hours (2 tubes)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Make new LB+KAN+MG1655&Delta;</span><em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></em><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em><span style="background: white;"> overnight culture for 22 hours (2 tubes)</span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Shaker in autoclave room</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">37&deg;C incubator in room 301</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Spectrophotomter</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol: </span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">iGEM protocols used for LB+agar, interlab protocol used for CFU experiement</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">IPTG dilution #1 in LB</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1</sub>V<sub>1</sub> = C<sub>2</sub>V<sub>2</sub></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1 </sub>= 1M</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>2 </sub>= 3mM</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>2 </sub>= 10mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>1 </sub>= 30<span style="background: white;">&mu;L</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">= take 30ul of stock and add to 10mL LB+KAN</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">IPTG dilution #2 in LB</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1</sub>V<sub>1</sub> = C<sub>2</sub>V<sub>2</sub></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1 </sub>= 3mM</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>2 </sub>= 3uM</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>2 </sub>= 25mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>1 </sub>= 25<span style="background: white;">&mu;L</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">= take 25ul of dilution #1 and add to LB+KAN</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">pET28a+</span></u><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">arg1</span></u></em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> overnight culture</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">1:8 dilution, measure OD, OD = 0.25</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">0.25x8 = 2</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1</sub>V<sub>1</sub> = C<sub>2</sub>V<sub>2</sub></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">C</span><sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">1 </span></sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">= 2</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">C</span><sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">2 </span></sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">= 0.3</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">V</span><sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">2</span></sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;"> = 25mL </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>1</sub> = 3.75mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Total volume = 25mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">25mL - 3.75mL = 21.25mL </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-21.25mL LB + KAN + 3.75mL overnight culture</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">-21.25mL LB + KAN + IPTG + 3.75mL overnight culture</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Abs<sub>600</sub> blank (LB+KAN+IPTG) = 0.00 (tared)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Abs</span><sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">600</span></sub><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;"> (LB+KAN+IPTG+ARG1) = 0.127</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Both tubes placed in shaker at 37&deg;C at 220 rpm (one with IPTG and one without)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">CFU colony count #2</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 2</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: right; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2B</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">180</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">138</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">40</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">77</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">78</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">91</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">16</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: right; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2D</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">215</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">150</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">149</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">83</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">115</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">274</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">45</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">28</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">28</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">30</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">14</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">28</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">dilution 5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Colony forming unit calculation (using Dilution 3 data)</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Calculated for Interlab Form IV</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">(# of colonies) x (Final Dilution Factor) = CFU/mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Final Dilution Factor = 8 x 10<sup>4</sup></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Colony 2</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;" rowspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2B</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8.64 x 10^6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.16 x 10^6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;" rowspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2D</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.72 x 10^7</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.64 x 10^6</span></p>
+</td>
+</tr>
+<tr>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.104 x 10^7</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.24 x 10^6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.2 x 10^7</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">9.20 x 10^6</span></p>
+</td>
+</tr>
+<tr>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.20 x10^6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.28 x 10^6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.192 x 10^7</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.192 x 10^7</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">MG1655&Delta;lacI+pET28a+arg1 streak to get single colonies</span></strong><br/><image src="https://static.igem.org/mediawiki/2018/2/24/T--Toronto--_ARG1_streaked_plate.jpg" height="350" width="350"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next Steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make KAN dilutions</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order primers</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order blue protein</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><span style="text-decoration: underline; font-size: 14pt;"><strong><span style="font-family: 'Times New Roman', serif;">Day 4, Thursday 21/06</span></strong></span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Daniel, Jasmeen, Nina</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make LB + KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make KAN dilutions</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make overnight culture of LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> for dry lab growth curve</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order primers for <span style="background: white;">pET28a+</span><em>arg1</em></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order blue protein</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Shaker in room 315</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">KAN dilutions</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">(800&mu;L of nuclease-free water+200<span style="background: white;">&mu;</span>L 50mg/mL KAN = 1mL 10mg/mL KAN) x3</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight culture of LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> for growth curve</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-(15mL LB + 75<span style="background: white;">&mu;</span>L KAN + incoulation from colony on newest <span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> plate) x3</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-tube placed in shaker at 37&deg;C at 220rpm</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">MG1655&Delta;lacI+pET28a+arg1 streak to get clonal colonies</span></strong><br/><image src="https://static.igem.org/mediawiki/2018/8/88/T--Toronto--_Clonal_ARG1_colonies.jpg" width="350" height="350"></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next Steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make KAN dilutions</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Do digest and run gel</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Dry lab growth curve</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order amilCP</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;">&nbsp;</p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><span style="text-decoration: underline; font-size: 14pt;"><strong><span style="font-family: 'Times New Roman', serif;">Day 5, Friday 22/06</span></strong></span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Nina, Daniel, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make LB + KAN plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Make KAN dilutions</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> growth curve</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order amilCP</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Shaker in autoclave room </span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Plate reader</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol: </span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">iGEM protocols for LB+agar and KAN dilutions</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">KAN dilutions</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-80mL of 10mg/mL were made</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-50 microcentrifuge tubes were filled with 1mL each and 30mL remains in a falcon tube in the fridge</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">LB+KAN+MG1655&Delta;</span></u><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></u></em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em> growth curve</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1:8 dilution made from each overnight culture (175mL LB+KAN and 25mL culture in well)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-200&mu;l LB+KAN pipetted in well (blank)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-measure OD<sub>600</sub></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-subtract blank value, multiply by 8 to get original concentration (OD)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-dilute each overnight culture to get an OD of 0.1</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-take OD again (0h timepoint)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-place the three replicates back in the shaker and measure again every hour (200<span style="background: white;">&mu;L</span>)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Volumes for LB+KAN+<span style="background: white;">MG1655&Delta;</span><em>lacI</em>+<span style="background: white;">pET28a+</span><em>arg1</em> in growth curve cultures based on OD values of 1:8 dilutions-blank value multiplied by 8</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Overnight culture 1 1:8 dilution OD without blank = 0.2209</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Overnight culture 1 </span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">original OD = 1.3576</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 1 LB+KAN = 23.158mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 1 overnight culture = 1.841mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Overnight culture 2 1:8 dilution OD without blank = 0.2167</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Overnight culture 2 original OD = 1.324</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 2 LB+KAN = 23.111mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 2 overnight culture = 1.888mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Overnight culture 3 1:8 dilution OD without blank = 0.2235</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Overnight culture 3 original OD = 1.3784</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 3 LB+KAN = 23.186mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Replicate 3 overnight culture = 1.814mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">LB+KAN+MG1655&Delta;</span></u><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">lacI</span></u></em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">+<span style="background: white;">pET28a+</span><em>arg1</em> in growth curve data</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.094</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0942</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1022</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">*0.0512</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1808</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1757</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1713</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.255</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2538</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #d10e0e;">*0.4448</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3391</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3247</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3332</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3937</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4075</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4032</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4539</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4688</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4326</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4652</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4797</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4705</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">*Replicate 3 OD at 2h has an incorrect measurement. All 2h replicates were retested an hour later and they all had very similar values.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">*All measurements shown already have the blank value subtracted from the raw value</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next Steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR pET28a+<em>arg1</em> with new primers</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Give Scott LB plate to streak with BL21</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+AMP plates (for gibson positive control)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order gibson</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Order amilCP</span></li>
+</ul>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
+<p>&nbsp;</p>
 				</div>
 			</div>
+                        <div class="page-section" id="4">
+				<button class="accordion">Week 4</button>
+				<div class="panel">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif; color: black;">Day 1, Monday 25/06</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Daniel, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make LB+AMP plates</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Autocleave tips (p200)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run practice PCR with pSB1C3 </span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;pSB1C3_UNS3_REV Primer</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;pSB1C3_UNS2_FWD Primer</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Autoclave</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Thermocycler</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Bunsen Burner</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6 x 50&mu;L reactions for amplifying pSB1C3</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-Primers 2.5 <span style="background: white;">ul * 6 = 15 ul * 2 (rev&amp;fwd)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">5x buffer (HF or GC) of Phusion ---&gt; 10<span style="background: white;">ul * 6 = 60ul</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">10mM of dNTPs ---&gt; 1<span style="background: white;">ul * 6 = 6ul</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">DMSO(100%) ---&gt; 6*50*3% = 9<span style="background: white;">ul</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Phusion polymerase ---&gt; 0.5*6 = 3<span style="background: white;">ul</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Nuclease free water ----&gt; 300ul - (60ul + 9ul + 3ul + 30 ul + 0.07ul) = 197.93 <span style="background: white;">ul (forgot to add 6ul dNTPs, solution more dilute)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">pSB1c3 (142ng/<span style="background: white;">ul)-----&gt; 0.07ul (0.1ul used)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">UNS3 _rev : CGACCTTGATGTTTCCAGTCCGATTGAGGACCTTCAGTGCCTCTAGAAGCGGCCGCG</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">uns2_FWD: GCTGGGAGTTCGTAGACGGAAACAAACGCAGAATCCAAGCTACTAGTAGCGGCCGCT</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">NEB temp: 72&deg;C</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">LB+AMP plates:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Accoding to the protocol found in iGEM binder.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>1</sub>= 50mg/<span style="background: white;">&mu;L</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">C<sub>2</sub>=50ug/mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>2</sub>=500mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">V<sub>1</sub>=0.5mL</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run practice PCR with protocol on thermocycler</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run gel for PCR product</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Overnight culture for growth curve</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Innoculation for growth curve (3x50mL falcon tubes)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif; color: black;">Day 2, Tuesday 26/06</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Daniel, Nina, Jasmeen, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run practice PCR with protocol on thermocycler</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run gel for PCR product</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Overnight culture for growth curve</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Innoculation for growth curve (3x50ml falcon tubes)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Thermalcycler</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Shaker</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Electrophoresis machine</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;UV light for gel visualization</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Used protocols from iGEM binder for casting and loading gel for gel electrophoresis. Used protocol from Phusion for PCR reaction.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Growth Curve</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-add 25mL LB+KAN to 3 50mL falcon tubes</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-run blank readings</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-innoculate 3 tubes with clonal ARG1 plasmid in MG1655deltalacI and take OD readings every 30 mins for 10 hours</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR mastermix</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">FWD PSB1C3 UNS2 505.7 ng/ul (nanodrop)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">REV PSB1C3 UNS 3 894.1 ng/ul <span style="background: white;">(nanodrop)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">4 x 50ul reactions</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-5x buffer 10ul x 4 = 40ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10mM dNTPs 1ul x 4 = 3ul (wrong)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-DMSO 1.5ul x 4 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-phusion polymerase 0.5ul x 4 = 2ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-RFP plasmid (142 ng/ul)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-dilute to 1ng/ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-141ul UP water + 1ul RFP plasmid</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10ng x 4 = 10ul x 4 = 40ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-FWD primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-dilute to 1ng/ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-504.7 UP water + 1ul primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2.5ul x 4 = 10ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-REV primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-dilute to 1ng/ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-893.1 UP water + 1ul primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-2.5ul x 4 = 10ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-UP water 50ul x 4 - (40ul + 3ul + 6ul + 2ul + 40ul + 10ul + 10ul) = 89ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-add 50ul of mastermix to 3 PCR tubes</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Thermocycler settings</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Hot start: 98 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Denaturing: 98 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Annealing: 98 degrees - 10s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">72 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">72 degrees - 90s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Extension: 72 degrees - 10min</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Hold: 4 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel electrophoresis:</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-nanodrop of product concentrations</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">600.2 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">341 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">398 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">403.4 ng/ul </span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">313 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">269 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">280 ng/ul</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">323 ng/ul</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR 1-5 = PCR products from 06/25/18</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR 1.1-1.3 = PCR products from 06/26/18</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-make dilutions usch that each PCR product has a concentration of 10ng/ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-take 1ul of product and dilute in UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-eg. 1ul PCR 1 + 59ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-take 10ul of dilution and mix with 2ul loading dye</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-load 12ul into wells</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-V = 100</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-A = 3.00 max</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-W = 300 max</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">DNA wells in gel</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA ladder (0.1-10kb)</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 4</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 5</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.3</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Finish dry lab growth curve <span style="background: white;">for MG1655deltalacI in LB+KAN</span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif; color: black;">Day 3, Wednesday 27/06</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Amalia, Jasmeen, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Finish dry lab growth curve for MG1655deltalacI in LB+KAN</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Run PCR with undiluted DNA</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave beakers and jars</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Streak out BL21 on an LB plate</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Autoclave</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Electrophoresis machine</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel doc in room 319</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Bunsen burner</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">Used protocols from iGEM binder for casting and loading gel for gel electrophoresis. </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel electrophoresis:</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-load wells</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-V = 100</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-A = 3.00 max</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-W = 300 max</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Dry lab growth curve for MG1655deltalacI in LB+KAN data</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Blank</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0465</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0469</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0475</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0009</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0012</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0006</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0006</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.007</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0015</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0017</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.002</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0008</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.005</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0006</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0026</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0024</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0021</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0125</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0112</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0073</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0052</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0099</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0135</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0182</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0218</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0301</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0026</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0475</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0569</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0675</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1095</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1241</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.105</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1352</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1496</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1894</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2295</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2437</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2181</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2469</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2506</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2452</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2818</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2734</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2649</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3103</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2781</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8*</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3018</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3585</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3656</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3376</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.364</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3548</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">9</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.358</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3953</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3864</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">9.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.3888</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4057</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.404</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4101</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4305</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4261</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4494</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4483</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4571</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">11.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.468</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4638</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.4764</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">23</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.8631</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.9021</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.963</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">*this measurement was taken after being out of the shaker for 30 mins</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">All measurements shown already have the blank value subtracted from the raw value</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel electrophoresis for PCR</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA ladder</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 4</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 5</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1.3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR 1</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR 1-5 = PCR products from 06/25/18</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR 1.1-1.3 = PCR products from 06/26/18</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gel from PCR.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Potential reasons for this result:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-PCR did not work</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-the annealing temperature was wrong because it was calculated using the whole primer, instead of only the binding sequence</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-the primers don't work</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">-the primers were suspended in water instead of TE buffer and could therefore be degraded</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-nanodrop had inaccurate measurement for primer concentrations since they were old and small</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-the primers were diluted to a concentration that would make them the limiting reagent for the reaction</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make LB</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Overnight culture of BL21</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;PCR ARG1 + UNSs</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Transform ARG1 into BL21</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif; color: black;">Day 4, Thursday 28/06</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Ahmed, Amalia, Daniel, Jasmeen, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make LB</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;PCR ARG1 + UNSs</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Transform ARG1 into BL21</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;RFP digest</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Autoclave</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Shaker in autoclave room</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Benchtop incubator with shaker</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Bunsen burner</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Thermocycler</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Electrophoresis machine</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Gel doc</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Used protocols from NEB for PCR and digestion</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR mastermix</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">6 x 20ul reactions</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">UNS3 FWD</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">UNS2 REV</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-5x HF buffer 4ul x 6 = 24ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10mM dNTPs 0.4ul x 6 = 2.4ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10uM FWD primer 1ul x 6 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM FWD primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10uM REV primer 1ul x 6 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM REV primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-ARG 1 - dilute to 1ng/ul (original 39.3ng/ul)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul ARG1 + 38.3ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul x 6 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-phusion DNA polymerase 0.2ul x 6 = 1.2ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-DMSO 0.6ul x 6 = 3.6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-UP water 20ul x 6 - (24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul) = 89ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-add 20ul of mastermix to 5 PCR tubes</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-annealing temperature = 60 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Thermocycler settings</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Denaturing: 98 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Annealing x30: 98 degrees - 10s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">60 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">72 degrees - 363s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Extension: 72 degrees - 10min</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Hold: 4 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">RFP digest</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul SPeI</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul EcoRI-HF</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-7ul RFP plasmid</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-5ul 10x cutsmart</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-36ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel for ARG1 PCR</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA ladder 1kb</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">NTC</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Table 5 - concentration of template is too high because the plasmid was not diluted, proper concentrations in gel represented by table 6</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Gel for ARG 1 PCR with correct concentrations</span></u></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA ladder 1kb</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.4</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">NTC</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Digest</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run gels with a different ladder</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Rerun gels with fresh TAE buffer</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Do a PCR using the thermocycler in room 303 of PSB1C3 + RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;">&nbsp; &nbsp; &nbsp;Do a PCR using the thermocycler in room 403 of PSB1C3 + RFP and colony PCR primers</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make competent BL21 cells</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif; color: black;">Day 5, Friday 29/06</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">People In Lab:</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;"> Ahmed, Amalia, Daniel, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run gels with a different ladder</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Rerun gels with fresh TAE buffer</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Do a PCR using the thermocycler in room 303 of pSB1C3+RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black; background: white;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;</span>Do a PCR using the thermocycler in room 403 of pSB1C3+RFP and colony PCR primers</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make competent BL21 cells</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Autoclave baffel flasks</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Equipment used:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Thermocycler in 303</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Thermocycler in 403</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Electrophoresis machine</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Gel doc</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Autoclave</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">PCR mastermix</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">pSB1C3+RFP with pSB1C3 colony primers</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">6 x 20ul reactions</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-5x HF buffer 4ul x 6 = 24ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10mM dNTPs 0.4ul x 6 = 2.4ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10uM FWD primer 1ul x 6 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM FWD primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-10uM REV primer 1ul x 6 = 6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM REV primer</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-RFP - dilute to 1ng/ul (original 142ng/ul)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul RFP + 141ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-1ul x 6 = 6ul - 1 (NTC) = 5ul </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-phusion DNA polymerase 0.2ul x 6 = 1.2ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-DMSO 0.6ul x 6 = 3.6ul</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-total in mastermix without water or template = <span style="background: white;">24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul = 43.2ul = 7.2ul per reaction</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-for NTC: 7.2ul mastermix + 12.8ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-for remaining mastermix: 100ul - (43.2ul - 7.2ul NTC) - 5ul RFP = 59ul UP water</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-add 20ul of mastermix to 5 PCR tubes</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">-temperature gradient:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">1: 55 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">2: 59.3 <span style="background: white;">degrees</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">3: 61 <span style="background: white;">degrees</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">4: 65 <span style="background: white;">degrees</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">NTC: 61 <span style="background: white;">degrees</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Thermocycler settings</span></u></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Denaturing: 98 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Annealing x30: 98 degrees - 10s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">55-60 degrees - 30s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">72 degrees - 363s</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Extension: 72 degrees - 10min</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Hold: 4 degrees</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Observations:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Jun 29th 2018 Thermo Phusion Arg1 UNS2 FWD and UNS3 REV at 60C room 303.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Jun 29th 2018 Thermo Phusion Arg1 (1ng) UNS2 FWD and UNS3 REV and digest at 60C room 303.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><img src="https://static.igem.org/mediawiki/2018/e/ee/T--Toronto--Jun29th2018_Thermo_Phusion_Arg1_Arg1UNS2FWDUNS3_REV60C.jpeg" alt="1" style="width:100%"></span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><img src="https://static.igem.org/mediawiki/2018/2/26/T--Toronto--Gel_from_PCR.jpg" alt="1" style="width:100%"></span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">Next steps:</span></strong></p>
+<ul style="list-style-type: square;">
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Temperature gradient PCR without DMSO</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Find Susie to do a biowaste disposal and autoclaving</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Redesign primers for <em>arg1</em></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+	                </div>
+			       </div>
+                        <div class="page-section" id="5">
+				<button class="accordion">Week 5</button>
+				<div class="panel"><p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 1, Tuesday 03/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Tashi, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth curve for BL21 + Arg1 -&gt; innoculation</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol:</span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth Curve(BL-21 cells + arg1 plasmid)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;We started from innoculation.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;For first 2 hours, we took the OD measurement every 30 minutes.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;After 2 hours, we took the OD measuremetn every 15 minutes.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Growth Curve</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">OD Measurements ( in triplicate)</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Time (h)</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 3</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0128</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0032</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.009</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.89279</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0018</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0015</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0045</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.74473</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0015</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0024</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.88606</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0075</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0065</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.18709</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0012</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0019</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0065</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.92082</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0007</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.008</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.1549</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0006</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0078</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.88606</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.22185</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0032</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0052</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0069</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.49485</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.284</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0026</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0061</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.58503</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0014</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.85387</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0011</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0053</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.95861</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0056</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0003</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0057</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.25181</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.52288</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0076</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0001</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0061</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.11919</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0008</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0009</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.09691</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.04576</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0051</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0059</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.29243</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0049</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0034</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0024</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.3098</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.46852</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.007</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0088</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0043</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.1549</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.05552</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.36653</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0156</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0193</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0187</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.80688</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.71444</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.72816</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0293</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0403</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0462</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.53313</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.39469</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.33536</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0681</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0828</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0946</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.16685</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.08197</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.02411</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1115</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1328</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1299</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.95273</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.8768</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.88639</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1629</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2011</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2112</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.78808</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.69659</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.67531</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Plan for future:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Redo growth curve and take OD measurements every 30 minutes.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 2, Wednesday 04/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Individual Name:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Tashi, Amalia, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate BL21+arg1 and BL21 cells</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;IPTG induction</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make liquid LB medium</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol: </span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Floatation Assay:</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction </span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;When OD<sub>600</sub> = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 3, Thursday 05/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Floatation Assay</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Pick the overnight induction sample and measure the OD</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;IPTG induction for newly inoculated culture</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth curve with BL21+arg1 cells ( 30mins interval)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol: </span></strong></p>
+<p><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1. Floatation Assay:</span></p>
+<ul>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Based on Shapiro Lab protocol</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">centrifuge the sample tubes under 350g for 4 hrs</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3 sample tubes were set on the benchtop</span></li>
+</ul>
+<p><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Change plan for the floatation assay:</span></strong></p>
+<ul>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">starting from 5 ml of overnight culture for 16hrs</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1:100 dilution of the starting culture and let the OD reaches 0.5</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Add IPTG to make conc. of 0.4mM(</span></strong><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">maybe 0.8mM for cell line we used</span></u></em><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">) in the cell culture and start the induction for 22hrs under 30<sup>o</sup>C.</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">After induction, centrifuge under 350g for 4 hrs</span></strong></li>
+</ul>
+<p><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2. Growth curve:</span></p>
+<ul>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">starting from inoculation</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">the cell was grown in shaker( 220RPM &amp; 37<sup>o</sup>C)</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Take the OD every 30 mins ( add 200ul to the plate reader)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Flotation observation:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1 Benchtop.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+IPTG Benchtop.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1+IPTG Benchtop.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed</strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1 centrifuged.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21 + IPTG Centrifuged.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed why</strong></span><strong><span style="font-size: 12.0pt; font-family: 'MS Gothic';">？</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1+IPTG centrifuged.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed</strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Growth Curve:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0-11 hrs</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">14.5-25 hrs</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #33a3bd; background: #33A3BD;">&nbsp;</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #33a3bd; background: #33A3BD;">&nbsp;</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 4, Friday 06/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Streak the plate of BL-21 non-transformed cell onto LB only plate</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run PCR with Phusion</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Re-design the Arg1-UNS2&amp;uns3 primers</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol:</span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56<sup>0</sup>C</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;HF buffer 5X 8ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10mM dNTPs 0.8ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10um FWD primer 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10um REV primer 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;1ng/ul Arg1 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;phusion DNA polyemrase 0.4ul</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: no band observed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p>&nbsp;</p>
+	                </div>
+			       </div>
+                        <div class="page-section" id="6">
+				<button class="accordion">Week 6</button>
+				<div class="panel">
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 1, Tuesday 03/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Tashi, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth curve for BL21 + Arg1 -&gt; innoculation</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol:</span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth Curve(BL-21 cells + arg1 plasmid)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;We started from innoculation.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;For first 2 hours, we took the OD measurement every 30 minutes.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;After 2 hours, we took the OD measuremetn every 15 minutes.</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Growth Curve</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;" colspan="3">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">OD Measurements ( in triplicate)</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">&nbsp;</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Time (h)</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">log 3</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0128</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0032</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.009</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.89279</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0018</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0015</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0045</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.74473</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0015</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0024</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.88606</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0075</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0065</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.18709</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0012</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0019</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0065</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.92082</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0007</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.008</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.1549</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0013</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0006</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0078</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.88606</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.22185</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0032</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0052</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0069</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.49485</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.284</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0026</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0061</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.58503</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0014</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.85387</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0011</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0004</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0053</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.95861</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.39794</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0056</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0003</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0057</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.25181</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.52288</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0076</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0001</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0061</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.11919</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0008</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0009</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0073</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.09691</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-3.04576</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0051</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0002</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0059</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.29243</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0049</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0034</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.0024</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.3098</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.46852</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">/</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.007</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0088</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0043</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.1549</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.05552</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-2.36653</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0156</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0193</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0187</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.80688</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.71444</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.72816</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0293</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0403</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0462</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.53313</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.39469</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.33536</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0681</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0828</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.0946</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.16685</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.08197</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-1.02411</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7.75</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1115</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1328</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1299</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.95273</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.8768</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.88639</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8.25</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.1629</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2011</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.2112</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.78808</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.69659</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; text-align: center; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">-0.67531</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Plan for future:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Redo growth curve and take OD measurements every 30 minutes.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 2, Wednesday 04/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Individual Name:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Tashi, Amalia, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate BL21+arg1 and BL21 cells</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;IPTG induction</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Make liquid LB medium</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol: </span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Floatation Assay:</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction </span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;When OD<sub>600</sub> = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 3, Thursday 05/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Floatation Assay</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Pick the overnight induction sample and measure the OD</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;IPTG induction for newly inoculated culture</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Growth curve with BL21+arg1 cells ( 30mins interval)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol: </span></strong></p>
+<p><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1. Floatation Assay:</span></p>
+<ul>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Based on Shapiro Lab protocol</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">centrifuge the sample tubes under 350g for 4 hrs</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3 sample tubes were set on the benchtop</span></li>
+</ul>
+<p><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Change plan for the floatation assay:</span></strong></p>
+<ul>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">starting from 5 ml of overnight culture for 16hrs</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1:100 dilution of the starting culture and let the OD reaches 0.5</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Add IPTG to make conc. of 0.4mM(</span></strong><em><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">maybe 0.8mM for cell line we used</span></u></em><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">) in the cell culture and start the induction for 22hrs under 30<sup>o</sup>C.</span></strong></li>
+<li><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">After induction, centrifuge under 350g for 4 hrs</span></strong></li>
+</ul>
+<p><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2. Growth curve:</span></p>
+<ul>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">starting from inoculation</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">the cell was grown in shaker( 220RPM &amp; 37<sup>o</sup>C)</span></li>
+<li><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Take the OD every 30 mins ( add 200ul to the plate reader)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Flotation observation:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1 Benchtop.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+IPTG Benchtop.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1+IPTG Benchtop.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed</strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1 centrifuged.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21 + IPTG Centrifuged.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed why</strong></span><strong><span style="font-size: 12.0pt; font-family: 'MS Gothic';">？</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+arg1+IPTG centrifuged.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: <strong>Floating tissue observed</strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Growth Curve:</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0-11 hrs</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">14.5-25 hrs</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #33a3bd; background: #33A3BD;">&nbsp;</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #33a3bd; background: #33A3BD;">&nbsp;</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 4, Friday 06/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Streak the plate of BL-21 non-transformed cell onto LB only plate</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Run PCR with Phusion</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Re-design the Arg1-UNS2&amp;uns3 primers</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol:</span></strong></p>
+<ul>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56<sup>0</sup>C</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;HF buffer 5X 8ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10mM dNTPs 0.8ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10um FWD primer 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;10um REV primer 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;1ng/ul Arg1 2ul</span></li>
+<li style="margin-bottom: .0001pt; text-indent: -18.0pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;">&nbsp; &nbsp; &nbsp;phusion DNA polyemrase 0.4ul</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: no band observed</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p>&nbsp;</p>
+	                </div>
+			       </div>
+                        <div class="page-section" id="7">
+				<button class="accordion">Week 7</button>
+				<div class="panel"><p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 1, Monday 16/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Nina, Tashi, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Making AMP stock solution</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Make LB+ AMP plates</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Overnight cultures of BL21 and BL21+ Arg1</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Running very low on AMP powder</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;">&nbsp;</p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 2, Tuesday 17/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Daniel, Nina, Tashi, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda:</span></strong></p>
+<ul style="list-style-type: square;">
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR of ARG1 plasmid using new IDT primers (UNS3 REV &amp; UNS 2 FWD)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1:100 dilution BL21 +ARG 1 in baffle flask, BL21 in baffle flask</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocol:</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1. ARG1 new primer gradient PCR [64.5&deg;C-67&deg;C (extra rxn at 66&deg;C)]: </span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">7 RXNs 20ul each (One without a template)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">annealing temp: 66<sup>0</sup>C</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Reagent used:</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Q5 Buffer (4</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">l x 7) 28ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10mM FWD primer (1</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;"> x 7)</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> 7ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10mM REV Primer (1</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;"> x 7)</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> 7ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10mM dNTPs (0.4</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">l x 7)</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> 2.8ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Q5 ploymerase (0.2</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">l x 7) </span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.4ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">g/</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">l </span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Template DNA (6</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">&mu;</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;"> x 6)</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> 6ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nuc Water Total mix with template for each rxn = 7.6<span style="color: #344043; background: white;">&mu;l </span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">(20<span style="color: #344043; background: white;">&mu;l each rxn - 7.6&mu;l = 12.5&mu;l ) x 6 = </span>74.4ul H20 for mastermix </span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Total mix without template for each rxn = 6.6<span style="color: #344043; background: white;">&mu;l</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif; color: #344043; background: white;">20&mu;l each rxn - 6.6&mu;l = 13.5&mu;l H2O for NTC</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;2.&nbsp;</span><span style="font-family: 'Times New Roman', serif; font-size: 12pt;">OD readings of BL21+ARG1 and BL21 for induction.</span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1ml was taken out of each culture every hour and placed in a cuvette</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">OD was measured using a spectrophotometer</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3. </span><span style="font-family: 'Times New Roman', serif; font-size: 12pt;">Cultures were induced with IPTG at 2:40pm. replicate 1 of BL21+ARG1 was induced with 0.4mM of IPTG. Replicate 2 of BL21+ARG1 was induced with 0.8mM IPTG. BL21 cells were not induced with IPTG.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results </span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1. ARG1 PCR with new primers results </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">37291721_2649158358642891_3010098950041501696_n.jpg</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2. </span><span style="font-family: 'Times New Roman', serif; font-size: 12pt;">OD readings</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Time</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+ Arg1 rep1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21+Arg2 rep2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21 rep1</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1:16pm</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.086</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.097</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.323</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2:30pm</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.353</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.359</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.081</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 3, Wednesday 18/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Nina, Tashi</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;">&nbsp;</p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="text-decoration: underline;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda</span></span></strong></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Dpn1 digest of PCR1 product</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR purification of PCR1 products</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nanodrop of PCR1 products after digest and purification</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Overnight culture LB+BL21</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Overnight culture of DH10B Arg1 and pSB1C3</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">place tubes in centrifuge 1hr</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Dpn1 Digest </span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">We have 10ul of PCR product per tube [4 tubes]</span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">8ul of PCR product</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1 ul of Dpn1</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1 ul of cutsmart (10x)</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10 ul of rxn (total)</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR Purification </span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">(16,000 g/ 13,000 rpm)</span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">30 ul sample</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2:1 ratio binding buffer sample = 60ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Load sample onto column</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">spin 1 min and discard flow through</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">reinsert column, add 200ul repeat DNA wash buffer</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Transfer column to 1.5ml centrifuge tube</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">add 6ul nuclease free water</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">wait 1 min, spin 1 min</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Completed <strong>nanodrop</strong> of 1ul of PCR purified product</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">concentration: <strong>100.1 ug/ul</strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 4, Thursday 19/07</span></u></strong></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Tashi, Ahmed, Daniel, Jasmeen</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda</span></strong></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR on new primers Arg1+UNS2FWD&amp;UNS3REV (anneailing temp 66&deg;C)</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nanodrop</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Purification of PCR products</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR product digest</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Cell competency for BL21</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gibson assembly (blue protein and Arg1+UNS1&amp;UNS3</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Miniprep: Arg1+cor, RFP + UNS</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Transform gibson into DH5</span><span style="font-size: 12.0pt; font-family: 'Cambria Math',serif;">⍺</span><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> cell from the kit</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">transform RFP from competency cell kit into BL21 cells</span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Protocols </span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR Calculation</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> (7 reactions planned) 50 ul</span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Master Mix for 8 reactions</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Reagent used:</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Q5 master mix (25&mu;l x 8) 200ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10mM FWD primer (2.5<span style="color: #344043; background: white;">&mu;l x 7)</span> 20ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">10mM REV Primer (2.5<span style="color: #344043; background: white;">&mu;l x 7)</span> 20ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1<span style="color: #344043; background: white;">&mu;g/&mu;l </span>Template DNA (2.5<span style="color: #344043; background: white;">&mu;l x 7)</span> 17.5ul</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nuc Water Total mix with template for each rxn = 17.5<span style="color: #344043; background: white;">&mu;l </span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">20<span style="color: #344043; background: white;">&mu;l for NTC</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">OD readings 1:100 dilution of BL21 for competency </span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Time</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21 rep1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">BL21 rep2</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">12:13pm</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.132</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.133</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">12.45pm</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.279</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.279</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1:08pm</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.459</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">0.466</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Note: Competency protocol was started after the last OD reading </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nanodrop ARG1 cor and RFP+UNS</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Plasmid</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Conc (ng/ul)</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">ARG1 cor</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">64.7</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">RFP+UNS</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">85.3</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">PCR gel for ARG1 and UNS (primers UNS2FWD, UNS3REV)</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1kb+ NEB ladder</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">3</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">4</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">5</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">NTC</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gel result</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DPN1 digest protocol</span></u></strong></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">For a 10<span style="color: #344043; background: white;">&mu;l rxn x 2 = 20&mu;l</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">16<span style="color: #344043; background: white;">&mu;l PCR product (well #1 ARG1 with UNS2FWD UNS3 primers)</span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2<span style="color: #344043; background: white;">&mu;l cutsmart buffer </span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2<span style="color: #344043; background: white;">&mu;l DPNI</span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA cleanup </span></u></strong></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2:1 ratio binding buffer :Digest product</span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">40<span style="color: #344043; background: white;">&mu;l buffer:20&mu;l digest product </span></span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">For elution step use 20<span style="color: #344043; background: white;">&mu;l nuclease free water </span></span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Nanodrop ARG1+UNS after cleanup </span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<table style="border-collapse: collapse;">
+<tbody>
+<tr>
+<td style="border: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Plasmid</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">conc(ng/&mu;l)</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">260/280</span></p>
+</td>
+<td style="border: solid black 1.0pt; border-left: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">260/230</span></p>
+</td>
+</tr>
+<tr>
+<td style="border: solid black 1.0pt; border-top: none; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">ARG1+UNS</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">75.4</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.96</span></p>
+</td>
+<td style="border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; padding: 0cm 7.5pt 0cm 7.5pt;">
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">1.65</span></p>
+</td>
+</tr>
+</tbody>
+</table>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gibson calculations (note limit for DNA in gibson rxn=0.2 picomoles)</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">ARG1+UNS</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA length=12209bp</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">picomoles we want= 0.0667pmol</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA Mass we had according to NEB calculator= 503.2ng</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">503.2ng/75.4ng/<span style="color: #344043; background: white;">&mu;l= 6.67&mu;l --&gt; ARG1+UNS added to gibson rxn</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Blue protein (K=BBa_K592009)</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA length= 764bp</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">picomoles we want= 0.1333333pmol</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">DNA mass we had according to NEB calculator=62.95ng</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Note: the blue protein was resuspended in 50<span style="color: #344043; background: white;">&mu;l of nuclease free water for a final concentration of 20ng/&mu;l</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">62.95ng/20ng/<span style="color: #344043; background: white;">&mu;l=3.15&mu;l--&gt; blue protein added to gibson </span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Transformation of gibson products</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gibson positive control (plated 100<span style="color: #344043; background: white;">&mu;l transformed DH5a (20&mu;l of DH5a cells + 2 &mu;l positive control gibson) onto AMP plate)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gibson positive control transformation (plated 100<span style="color: #344043; background: white;">&mu;l transormed DH5a (20&mu;l DH5a cells + positive control plasmid) onto AMP plate)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Gibson products (plated 50<span style="color: #344043; background: white;">&mu;l, 100&mu;l, 200&mu; transformed DH5a (50&mu;l DH5a cells + 2&mu;l of gibson product) onto KAN plates)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Tranformation of RFP plasmid from competency cell kit </span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">plated 100<span style="color: #344043; background: white;">&mu;l of transformed BL21 cells (100&mu;l BL21 cells + 10pg, 50pg, 100pg RFP plasmid) onto CAM plates </span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 14.0pt; font-family: 'Times New Roman',serif;">Day 5, Friday 20/07</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">People In Lab:</span></u></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;"> Amalia, Tashi, Ahmed, Nina</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="text-decoration: underline;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Agenda </span></strong></span></p>
+<ul>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Check Gibson and Bl21 competency plates </span></li>
+<li style="line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">re-transform Gibson positive controls and gibson products </span></li>
+</ul>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results from Gibson</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Both positive control plates (transformation control and gibson control) have colonies </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">None of the gibson product plates have colonies </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: Gibson plates: top left is positive control for transformation, top right is positive control for gibson, bottom 3 plates are plates with our gibson product transformation. Note the fact that only positive controls have colonies.</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Troubleshooting</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">transformation was repeated </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">6 KAM plates were plated each with 200<span style="color: #344043; background: white;">&mu;l of transformed DH5a cells (50&mu;l of DH5a cells transformed with 2&mu;l of gibson product)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">2 positive control plates: positive control for transformation (20<span style="color: #344043; background: white;">&mu;l of DH5a cells transformed with 2&mu;l positive control plasmid) </span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">positive control for gibson (20<span style="color: #344043; background: white;">&mu;l of DH5a cells transformed with 2&mu;l of positive control gibson)</span></span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><u><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Results competency plates</span></u></strong></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">plate plated with 50pg of plasmid grew 4 colonies </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">plate plated with 100pg of plasmid grew 3 colonies </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">plate plated with 10pg of plasmids did not grow colonies </span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: 10pg</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: 50pg</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">image.png</span></strong><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">: 100pg</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">Note: these photos were taken after 4 days of plating but small colonies were observed after incubation overnight</span></p>
+<p style="margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Times New Roman',serif;">&nbsp;</span></p>
+<p>&nbsp;</p>
+	                </div>
+			       </div>
+                       <div class="page-section hero" id="8">
+				<button class="accordion">Week 8</button>
+				<div class="panel">
+												<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/a/a8/T--Toronto--week8.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="9">
+				<button class="accordion">Week 9</button>
+				<div class="panel">
+												<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/5/53/T--Toronto--week9.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="10">
+				<button class="accordion">Week 10</button>
+				<div class="panel">
+												<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/6/62/T--Toronto--week10.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="11">
+				<button class="accordion">Week 11</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/b/b5/T--Toronto--week11.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="12">
+				<button class="accordion">Week 12</button>
+				<div class="panel">
+										<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/4/4d/T--Toronto--week12.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="13">
+				<button class="accordion">Week 13</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/4/48/T--Toronto--week13.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="14">
+				<button class="accordion">Week 14</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/d/d0/T--Toronto--week14.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="15">
+				<button class="accordion">Week 15</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/6/66/T--Toronto--week15.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="16">
+				<button class="accordion">Week 16</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/5/5f/T--Toronto--week16.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="17">
+				<button class="accordion">Week 17</button>
+				<div class="panel">
+										<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/d/da/T--Toronto--week17.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="18">
+				<button class="accordion">Week 18</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/a/aa/T--Toronto--week18.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="19">
+				<button class="accordion">Week 19</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/4/4d/T--Toronto--week19.pdf">
+                        </div>
+			       </div>
+                        <div class="page-section hero" id="20">
+				<button class="accordion">Week 20</button>
+				<div class="panel">
+					<embed style="width:100%; height: 1000px;" src="https://static.igem.org/mediawiki/2018/d/d8/T--Toronto--week20.pdf">
+                        </div>
+			       </div>
 			<!-- </div> -->

Difference between revisions of "Team:Toronto/WetLab/Notebook"

Latest revision as of 00:53, 18 October 2018

NoteBook