Latest revision as of 21:36, 15 November 2018

Methods

Experiments

Assembling the Pixcell Constructs

Access All

Description

This protocol describes how to create the Pixcell construct and Pixcell construct with a degradation tag using Golden Gate assembly. Creating each of the constructs takes approximately two days

Materials

pBR322

E.coli MG1655 genomic DNA

GFP Storage Vector

10µM of Primers

Q5 polymerase (New England Biolabs, #M0491)

1% Agarose Gel

TAE Buffer

Monarch® DNA Gel Extraction Kit (NEB, #T1020S)

Golden Gate Assembly Mix (NEB, E1600S)

DJ901 and Turbo Cells

KCM

Phusion polymerase (NEB, #M0530S)

T4 DNA ligase (NEB, #M0202)

Notes

Part	Description
pBR322	A medium copy vector encoding ampicillin resistance with a pMB1,origin of replication and a mcherry cassette with BsaI sites on either end.
SoxRS	The gene encoding the transcription factor Sox R and the bidirectional promoter pSoxS/pSoxR which it regulates
GFP	Superfolded GFP which is used as a reporter gene to be placed under the control of inducible side of the promoter, pSoxS

Procedure

Name	Template	Direction	Function	Tm(°C)	Sequence
PPC1	MG655 Genome	Forward	Amplification of SoxRS regulon	67.1	CTAGTGGGTCTCCCTCGAGAGAAAGACAAAGACCGG
PPC2	MG1655 Genome	Reverse	Amplification of SoxRS regulon	64	GTCGATGGTCTCCCATAAATCTGCCTCTTTTCAGTG
PPC3	GFP Storage Vector	Forward	Amplification of GFP	65	GTCGATGGTCTCGTATGCGTAAAGGCGAAGAA
PPC4	GFP Storage Vector	Reverse	Amplification of GFP	68	CTAGTGGGTCTCGGGACAGTAGCGAAAAAACCCCG
PPC5	PixCell Construct	Forward	Addition of a degradation tag	65	GCAAACGACGAAACTACGCTTTAGTAATGATACTAGAGCGCAAAAAACCCC
PPC6	PixCell Construct	Reverse	Addition of a degradation tag	65	CTAAAGCGTAGTTTCGTCGTTTGCCTTATACAGCTCGTCCATACCGTGG

PCR Reactions

SoxRS regulon Amplification

The PCR was carried out using the primers PPC1 and PPC2 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 59.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

GFP Amplification.

The PCR was carried out using the primers PPC3 and PPC4 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 61.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

Gel Electrophoresis

Both PCR product were run on a 1% agarose gel and extracted using the New England Biolabs gel extraction kit using the recommended protocol.

Golden Gate Assembly

The two amplicons were cloned into the pBR322 vector by adding 75ng of pBR322 and 30.1ng of SoxRS regulon and 23.4ng of GFP amplicon to the golden gate assembly mix (NEB, E1600S). Following the NEB protocol the mixture was incubated at 37°C for 1 hr and at 55°C, 5 mins.

Transformation

The PixCell construct was transformed into DJ901 and Turbo cells using the KCM heat shock protocol.

Addition of the Degradation Tag

Turbo cells containing the PixCell construct were grown overnight and miniprepped following the NEB protocol in order to obtain template DNA for the following PCR reaction. The PCR was carried out using the primers PPC5 and PPC6 and Phusion polymerase (New England Biolabs) with 3% DMSO. Following a protocol of 30 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 3 minutes, and a final extension at 72 °C for 10 minutes. These primers produce complementary overhangs which when ligated together add a degradation tag we designed to the 3’ end of the coding region of GFP.

Ligation

The ends of the PCR amplicon produced from the primers PPC5 and PPC6 were ligated using T4 DNA ligase (NEB) following the recommended NEB protocol.

Transformation
The PixCell construct with deg tag was transformed into DJ901 cells using the KCM heat shock protocol.

Characterizing Pixcell Constructs

Access All

Description

This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475. All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background. Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.

Materials

Autoclaved LB media
Autoclaved 10x concentated LB media
500 mM pyocyanin stock solution (from Sigma-Aldrich, CAS: No. 86-66-5)
125 mM potassium ferricyanide stock solution (from Sigma-Aldrich, CAS: No. 13746-66-2)
500 mM ferrocyanide stock solution (from Sigma-Aldrich, CAS 14459-95-1 )
20% Sodium Sulfite Solution
Agar plates with colonies of E. coli DJ901 strains with respective constructs: PixCell Patterning Circuit 1 (BBa_K2862021). PixCell Patterning Circuit 2 (BBa_K2862022), negative control (DJ901 WT) and positive control (constitutively expressed GFP).
37°C shaking incubator
BMG Labtech FLUOstar plate reader
4x Greiner BioOne 96-F 96-well microplate (black with clear bottom)
14 mL culture tubes
autoclaved eppendorfs

Notes

Work in very sterile conditions. To prevent contaminations in the blanks, use triple antibiotics.
Store pyocyanin and ferrocyanide and ferricyanide solutions in the freezer until use.
We used 10x concentrated LB in order not to dilute nutrients at higher pyocyanin concentration; this was back diluted with autoclaved water. Mastemixes have double the working concentrations, as 100 uL of solution is then diluted with 100 uL of liquid cultures.

Procedure

Grow starter liquid cultures of cells (Day 0, 10-15 min preparation + overnight)

Working in very sterile conditions, take 5 14mL culture tubes and prepare them according to table below:

Label	E. coli strain	Construct	Antibiotic (Ab)	V Ab (uL)	V LB (mL)
PC1	DJ901	BBa_K2862021	Kan + Amp	5 + 5	5
PC2	DJ901	BBa_K2862022	Kan + Amp	5 + 5	5
-	DJ901	none	Kan	5	5
+	DJ901	GFP_Boo	Kan + Chl	5 + 5	5
Blanks	None	None	Kan + Amp + Chl	5 + 5	5

With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator). We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)

Prepare mastermixes (30 min)

Mastermixes for each redox molecule concentration prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.

Mastermizes for Day 1 and Day 2 :

Condition	V Pyo (uL)	Kan (uL)	LB 10x uL	Autoclaved Water (uL)	Tot Vol (uL)
A = 0 mM Pyo	0	2.44	122	1098	1220
B = 0.01 mM Pyo	0.0976	2.44	122	1097.9024	1220
C = 0.025 mM Pyo	0.244	2.44	122	1097.756	1220
D = 0.05 uM Pyo	0.488	2.44	122	1097.512	1220
E = 0.1 mM Pyo	0.976	2.44	122	1097.024	1220
F = 0.25 mM Pyo	2.44	2.44	122	1095.56	1220
G = 0.5 mM Pyo	4.88	2.44	122	1093.12	1220
H = 1 mM Pyo	9.76	2.44	122	1088.24	1220

Mastermixes for Day 3 and Day 4:

Condition	V Pyo (uL)	Kan (uL)	LB 10x uL	Autoclaved Water (uL)	Tot Vol (uL)
A = 2.5 mM Pyo	24.4	2.44	122	1073.6	1220
B = 5 mM Pyo	48.8	2.44	122	1049.2	1220
C = 10 mM Pyo	97.6	2.44	122	1000.4	1220
D = 25 mM Pyo	244	2.44	122	854	1220
E = 50 mM Pyo	488	2.44	122	610	1220
F = 100 mM Pyo	976	2.44	122	122	1220

We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:

Condition	Volume of A-H Mastermix (uL)	Ampicillin (uL)	Chloramphenicol (uL)
PC1 + PC2	406	2.44	0
+	203	0	2.44
-	203	0	0
Blanks	406	2.44	2.44

Fill 96-well plate with media solutions

Add 100 uL of media in the desired wells, according following the label on mastermixes and table below:

	1	2	3	4	5	6	7	8	9	10	11	12
A	PC1	PC1	BA	PC2	PC2	BA	-	-	BA	+	+	BA
B	PC1	PC1	BB	PC2	PC2	BB	-	-	BB	+	+	BB
C	PC1	PC1	BC	PC2	PC2	BC	-	-	BC	+	+	BC
D	PC1	PC1	BD	PC2	PC2	BD	-	-	BD	+	+	BD
E	PC1	PC1	BE	PC2	PC2	BE	-	-	BE	+	+	BE
F	PC1	PC1	BF	PC2	PC2	BF	-	-	BF	+	+	BF
G	PC1	PC1	BG	PC2	PC2	BG	-	-	BG	+	+	BG
H	PC1	PC1	BH	PC2	PC2	BH	-	-	BH	+	+	BH

OD600 matching

After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL

Cell dilution calculator: Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells E.g. to dilute 5mL of cells at an OD600 of 0.3 to OD of 0.1 = [ (5mL*0.3)/0.1 - 5] =10 mL

Add cells to 96-well plate

We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.

Set up the script in the plate reader and start experiment

For Pyocyanin experiments:

We set up a script on the BMG Labtech Omega control software to perform endpoint absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200.

Data analysis

We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments

Electrochemistry of Redox Modulators

Access All

Description

Protocol for cyclic voltammetry and amperommetry experiments

Notes

Procedure

Square-wave voltammetry was obtained with the setup descripted in the results section.
Solutions in the flask containing the reference and working electrode were identical to the solutions in the respective flasks containing the counter electrode.
Square-wave voltammetry was performed with the PalmSens 4-channel MultiEmStat3 between -0.3 and +0.5 Volt.
The counter electrodes contained 60% Carbon with a diameter of 5mm. Working electrodes contained 90% Carbon with a 2mm diameter. Salt bridges were consists of 3% agar containing 1 molar potassium chloride inside plastic tubing. The reference electrode was produced by placing a silver wire within 3% agar containing 3 molar potassium chloride inside plastic tubing.
Square wave voltammetry was performed with the following treatment settings: 10s equilibrium time, voltage step of 0.005V, amplitude 0.05V, frequency 25 Hz, the voltage beginning at -0.3V and ending at 0.5V.
Amperometry was performed in a plate containing the final conditions: 10mM FCN(R), 2.5 uM Pyocyanin, 0.02% Sulfite, Ampicillin, Kanamycin and cells containing the PixCell construct with the following treatment settings: 10sec equilibrium time, time interval 0.05s run time up to 65000 seconds, V=+0.5.

Spatial Electronic Control of Gene Induction

Access All

Description

Given that we had determined the voltage by which pyocynanin becomes oxidised, we replicated that oxidation within a plate. Thereby turning on GFP expression by oxidising SoxR indirectly.

Procedure

Three 5mm holes were drilled into 9cm agar plates. Working, counter reference electrodes were prepared as described in the results section.
Electrodes were inserted into the plate penetrating 2mm and glued to the plate.
Solutions containing 10mM FCN(R), 2.5 mM Pyocyanin, 0.3% Sulfite, Ampicillin and Kanamycin were pitpetted into a 50ml falcon tube.
50ml of molten 1% agar was added to the falcon tube. Shaking ensured that the solution was well mixed. After mixing 22ml of the solution was pipetted onto the agar plate.
It was ensured that agar covered the electrodes fully.
After the agar was set, 100uL of cells containing the PixCell construct Deg Tag at an OD of 0.3. were plated onto the agar.
Afterwards the plate was turned upside down, closed and sealed using tape. The setup was then placed into a 37°C incubator.
Potentials were then applied overnight for 13h as described here.
To investigate fluorescence the agar was transferred onto a fresh plate without electrodes penetrating from the bottom. Fluorescence was measured using the Fujifilm FLA-5000 Fluorescent Image Analyser on the following settings: Laser wavelength: 250nm, filter: FITC, gradation: 65536 (16bit), resolution: 50uM. Images where then imported into imageJ for image analysis. Minimum brightness was set to 13867 in all images to discard small fluorescence values which correspond to background fluorescence.

Creating the Sox Library

Access All

Description

This protocol describes how to create a library of constructs varying two parts using BASIC assembly method. Following it we constructed a 48 constructs library, using 3 repeated parts and a variable promoter (pSoxS) with 8 variants, and a variable transcription factor (SoxR) with 6 variants (one of them unsubmitted to registry).

Notes

All the experiments for this part of the project were performed on E. coli DH5α, origin strain for DJ901, as this last one could not be made super-competent (109 cfu / μg pUC19 DNA) enough to transform BASIC assembly products. Individual parts were integrated in chloramphenicol resistant high copy plasmid pSB1C3_BASIC vectors and assemblies were performed in ampicillin resistant mid copy plasmid p15A vectors. All individual parts were synthesised and ordered as gblocks with BASIC prefix and suffix through IDT. The linkers used were provided by Biolegio and the adaptors were courtesy of Dr. Baldwin’s lab at Imperial College London.

Construct name	Promoter (pSoxS)	Transcription factor (SoxR)	Plasmid	Constitutive promoter	GFP
PC_A1	BBa_K2862006	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_A2	BBa_K2862006	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_A3	BBa_K2862006	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_A4	BBa_K2862006	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_A5	BBa_K2862006	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_A6	BBa_K2862006	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_B1	BBa_K2862007	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_B2	BBa_K2862007	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_B3	BBa_K2862007	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_B4	BBa_K2862007	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_B5	BBa_K2862007	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_B6	BBa_K2862007	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_C1	BBa_K2862008	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_C2	BBa_K2862008	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_C3	BBa_K2862008	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_C4	BBa_K2862008	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_C5	BBa_K2862008	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_C6	BBa_K2862008	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_D1	BBa_K2862009	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_D2	BBa_K2862009	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_D3	BBa_K2862009	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_D4	BBa_K2862009	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_D5	BBa_K2862009	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_D6	BBa_K2862009	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_E1	BBa_K2862010	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_E2	BBa_K2862010	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_E3	BBa_K2862010	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_E4	BBa_K2862010	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_E5	BBa_K2862010	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_E6	BBa_K2862010	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_F1	BBa_K2862011	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_F2	BBa_K2862011	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_F3	BBa_K2862011	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_F4	BBa_K2862011	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_F5	BBa_K2862011	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_F6	BBa_K2862011	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_G1	BBa_K2862012	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_G2	BBa_K2862012	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_G3	BBa_K2862012	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_G4	BBa_K2862012	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_G5	BBa_K2862012	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_G6	BBa_K2862012	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes
PC_H1	BBa_K2862013	BBa_K2862014	P15A-Amp	BBa_K2862019	Yes
PC_H2	BBa_K2862013	BBa_K2862015	P15A-Amp	BBa_K2862019	Yes
PC_H3	BBa_K2862013	BBa_K2862016	P15A-Amp	BBa_K2862019	Yes
PC_H4	BBa_K2862013	BBa_K2862017	P15A-Amp	BBa_K2862019	Yes
PC_H5	BBa_K2862013	BBa_K2862018	P15A-Amp	BBa_K2862019	Yes
PC_H6	BBa_K2862013	SoxR-8 (not submitted)*	P15A-Amp	BBa_K2862019	Yes

Figure 1. Table showing assembly parts combinations. RBS for GFP and SoxR were in the linker oligo, being RBS3 the one used for both GFP and SoxR.

*As SoxR-8 was original from C.amalonaticus a predicted human pathogen, we did not submit that part to the registry, however we worked with it because of its interesting properties.

Procedure

Parts assembly for library generation was performed as described in Storch, Casini et al., 2015. Briefly, linkers were prepared adding 49 µl of annealing buffer ( 10mM TRIS-HCl buffer pH7.9, 100mM NaCl, 10mM MgCl2 ) to 0.5 µl (1 µM) of linker and 0.5 µl (1 µM) of adapter oligos, and incubating at 95ºC for 1 min. Once linkers were ready they were mixed with the parts for the digestion/ligation reaction and incubated at 37ºC for 1 hour, 20ºC for 20 min, 65ºC for 20 min. Each 30 µl reaction had 3µl of ATP, 3µl of NEB4, 3µl BSA, 5µl of prefix linker (1µM), 5µl of suffix linker (1 µM), 1µl of BsaI (20 U/µl), 0.5 µl of T4 ligase (400 U/µl), 1µl DNA part (200 ng/µl) and water. Parts and linkers were mixed according to the following table.

Part	Promoter (for all 8 pSoxS)	Transcription factor (for all 6 SoxR)	Plasmid (p15A)	Constitutive promoter (Pfam2-J23101)	GFP
Linker prefix	LMP	UTR2-3	LMS	L5	UTR1-3
Linker suffix	UTR1-3	LMS	LMP	UTR2-3	L5

Figure 2. Linkers added to each part for assembly (linker notation is based on Stoch et al. 2015 analyzed linker data)

Digested parts were purified using Magbead purification in a AMPure XP magnetic purification kit according to manufacturer’s recommendations (Beckman Coulter). These were then assembled in 48 different combinations, to form our 48 different library constructs. Each 10vl assembly reaction contained 1µl of each purified DNA part with linkers, 1µl of NEB4 and 1µl of BSA. Assembly was performed incubating the mix at 50ºC for 45min.

Characterising the Sox Library

Access All

Description

The 48 parts library was characterised using the same procedures described for Pixcell construct characterisation (see previous protocol). The only difference is that instead of analysing each construct with 14 different inducer conscentrations we only analysed the base construct PC_A1. Then we characterised the other 47 constructs with only 3 inducer concentrations and fitted this data onto the sigmoidal curve created by PC_A1.

Notes

We determined that PC_A1 is our base construct as it is Pixcell construct in library format. This means that it has the same transcription factor (SoxR-0) and the same promoter (pSoxS-0) only that this one in Pfam1 promoter architecture. Therefore, this construct should give us the most similar results to Pixcell construct and show the effect of library architecture.

Procedure

Promoter induction assay

The best colonies from each succesful construct were characterised in an induction assay with pyocyanin. Assays were performed with different concentrations of pyocyanin (0-100 µM) and 100 µl of OD 0.1 cells in BMG Clariostat plate readers at 30º C.

Part growth assay

As some constructs did not grow any succesful colony we performed toxicity assays with the individual parts. Each part in pSB1C3-BASIC was transformed into E.coli DH5α strains using NEB high efficiency transformation protocol (C2987H/C2987I). Then succesful transformants were grown at 37ºC for 24 hours in a shaking BMG Clariostat plate reader and OD600 measurements were taken every 10min (see previous protocol in Pixcell construct characterization).

Biocontainment- Gp2 Growth Inhibition

Access All

Description

A biocontainment device to prototype one of our proposed applications. By placing this downstream of pSoxS we could inhibit cell growth in the oxidising conditions we can produce from our electrochemical set up. We envision this being used with our array in a biocontainment device in which any cells that spread to the edges of the device have their growth seized by an oxidising potential. This device could be used to prevent the accidental release of GMOs, much like how electric fences are used to restrain animals.

Procedure

Constructs were assembled by BASIC assembly into a low-copy number pSC101 backbone. SoxR was placed under the control of a medium strength RBS whereas Gp2 was constructed with an RBS library. Both RBSs were located within the BASIC linker sequences. Following assembly transformed cells were plated on LB-agar containing 10mM ferrocyanide and 0.02% sodium sulfite. Five biological replicates seeded from a single colony for each construct were grown out in LB containing 10mM ferrocyanide and 0.02% sodium sulfite for 6 hours. These cultures were then diluted to a final OD of 0.1. 5μl of each culture was added to 195μl LB solutions in a Greiner BioOne F-bottom 96-well plates to a final concentration of 2.5μl pyocyanin, 10mM ferricyanide and 0.02% sulfite for the OFF condition and to 2.5μl pyocyanin, 10mM ferrocyanide and 0.02% sulfite for the ON condition. Plates were incubated for 24 hours in a BMG Labtech FLUOstar at 37oC with absorbance readings at 600nm every 5 minutes.

Difference between revisions of "Team:Imperial College/Experiments"

Latest revision as of 21:36, 15 November 2018

Methods

Contents

Experiments

Assembling the Pixcell Constructs

Characterizing Pixcell Constructs

Electrochemistry of Redox Modulators

Spatial Electronic Control of Gene Induction

Creating the Sox Library

Characterising the Sox Library

Biocontainment- Gp2 Growth Inhibition

official.imperial.igem@gmail.com

@@ Line 6: / Line 6: @@
 <style>
-  #expt1, #expt2, #expt3, #expt4, #expt5, #expt6,#expt7,#expt8 {
+  #expt1, #expt2, #expt3, #expt4, #expt5, #expt6,#expt7,#expt8,#expt9 {
      width:100%;
      height:5px;
@@ Line 13: / Line 14: @@
 .contents ul{
-    width:40%;
      margin-top:6%;
      box-sizing: border-box;
@@ Line 20: / Line 20: @@
      background:none;
 }
+.contents{
+margin:auto;
+margin-left:30%;
+width: 50%;
+}
 .contents ul li{
@@ Line 33: / Line 39: @@
 .contents ul li a{
      text-decoration: none;
-     font-size: 30px;
+     font-size: 25px;
      font-family: 'Varela Round', sans-serif;
      color: #374785;
@@ Line 120: / Line 126: @@
      box-sizing: border-box;
 }
 </style>
@@ Line 144: / Line 152: @@
                      <li><a href="#expt3">Electrochemistry of Redox Modulators</a></li>
                      <li><a href="#expt4">Spatial Electronic Control of Gene Induction</a></li>
-                     <li><a href="#expt5">1Creating the Sox Library</a></li>
+                     <li><a href="#expt5">Creating the Sox Library</a></li>
                      <li><a href="#expt6">Characterising the Sox Library</a></li>
-                    <li><a href="#expt7">Testing Phenazine Methosulfate</a></li>
                      <li><a href="#expt7">Biocontainment- Gp2 Growth Inhibition</a></li>
-                    <li><a href="#expt8">Fabric Bioprinting - Melanin</a></li>
                  </ul>
              </div>
@@ Line 160: / Line 166: @@
                  <!--Start Experiment 1-->
                  <div id="expt1"></div>
-                 <h4> 1-State Construct Assembly</h4>
+                 <h4 class="underbold"> Assembling the Pixcell Constructs</h4>
                  <div onclick="expandAll('expt1p');" class="expandButton">
                           <p class="expand expt1p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 172: / Line 178: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>This protocol describes how to create the Pixcell construct and Pixcell construct with a degradation tag using Golden Gate assembly. Creating each of the constructs takes approximately two days </p>
                  </div>
-                 <div type="button" class="accordion">Relevance</div>
+                 <div type="button" class="accordion">Materials</div>
                  <div class="panel expt1p">
-                     <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p >  <li>pBR322</li>
+                            <li>E.coli MG1655 genomic DNA</li>
+                            <li>GFP Storage Vector</li>
+                            <li>10µM of Primers</li>
+                            <li>Q5 polymerase (New England Biolabs, #M0491) </li>
+                            <li>1% Agarose Gel</li>
+                            <li>TAE Buffer</li>
+                            <li>Monarch® DNA Gel Extraction Kit (NEB, #T1020S)</li>
+                            <li>Golden Gate Assembly Mix (NEB, E1600S)</li>
+                            <li>DJ901 and Turbo Cells</li>
+                            <li>KCM</li>
+                            <li>Phusion polymerase (NEB, #M0530S) </li>
+                            <li>T4 DNA ligase (NEB, #M0202) </li>
+ </p>
                  </div>
-                 <div type="button" class="accordion">Brief Method</div>
+                 <div type="button" class="accordion">Notes</div>
                  <div class="panel expt1p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+<table class="tg">
+  <tr>
+    <th class="tg-7q3x">Part </th>
+    <th class="tg-0lax">Description</th>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">pBR322</td>
+    <td class="tg-m9r4">A medium copy vector encoding ampicillin resistance with a pMB1,origin of replication and a mcherry cassette with BsaI sites on either end.</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">SoxRS</td>
+    <td class="tg-m9r4">The gene encoding the transcription factor Sox R and the bidirectional promoter pSoxS/pSoxR which it regulates</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">GFP</td>
+    <td class="tg-m9r4">Superfolded GFP which is used as a reporter gene to be placed under the control of inducible side of the promoter, pSoxS</td>
+  </tr>
+</table>
+ </p>
                  </div>
+                 <div type="button" class="accordion" >Procedure</div>
-                 <div type="button" class="accordion" >Summary</div>
                  <div class="panel expt1p">
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
+<style type="text/css">
+.tg  {border-collapse:collapse;border-spacing:0;}
+.tg td{font-family:Arial, sans-serif;font-size:12px;padding:10px 5px;border-style:solid;border-width:1px;overflow:visible;word-break:normal;border-color:black;}
+.tg th{font-family:Arial, sans-serif;font-size:12px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:visible;word-break:normal;border-color:black;}
+.tg .tg-958c{background-color:#ffcc67;border-color:inherit;text-align:center;vertical-align:top}
+.tg .tg-mfhl{background-color:#ffffc7;border-color:inherit;text-align:center;vertical-align:top}
+</style>
+<table class="tg">
+  <tr>
+    <th class="tg-958c">Name</th>
+    <th class="tg-958c">Template</th>
+    <th class="tg-958c">Direction</th>
+    <th class="tg-958c">Function</th>
+    <th class="tg-958c">Tm(°C)</th>
+    <th class="tg-958c">Sequence</th>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC1</td>
+    <td class="tg-mfhl">MG655 Genome</td>
+    <td class="tg-mfhl">Forward</td>
+    <td class="tg-mfhl">Amplification<br>of SoxRS regulon</td>
+    <td class="tg-mfhl">67.1</td>
+    <td class="tg-mfhl">CTAGTGGGTCTCCCTCGAGAGAAAGACAAAGACCGG</td>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC2</td>
+    <td class="tg-mfhl">MG1655 Genome</td>
+    <td class="tg-mfhl">Reverse</td>
+    <td class="tg-mfhl">Amplification of SoxRS regulon</td>
+    <td class="tg-mfhl">64</td>
+    <td class="tg-mfhl">GTCGATGGTCTCCCATAAATCTGCCTCTTTTCAGTG</td>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC3</td>
+    <td class="tg-mfhl">GFP Storage Vector</td>
+    <td class="tg-mfhl">Forward</td>
+    <td class="tg-mfhl">Amplification of GFP</td>
+    <td class="tg-mfhl">65</td>
+    <td class="tg-mfhl">GTCGATGGTCTCGTATGCGTAAAGGCGAAGAA</td>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC4</td>
+    <td class="tg-mfhl">GFP Storage Vector</td>
+    <td class="tg-mfhl">Reverse</td>
+    <td class="tg-mfhl">Amplification of GFP</td>
+    <td class="tg-mfhl">68</td>
+    <td class="tg-mfhl">CTAGTGGGTCTCGGGACAGTAGCGAAAAAACCCCG</td>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC5</td>
+    <td class="tg-mfhl">PixCell Construct</td>
+    <td class="tg-mfhl">Forward</td>
+    <td class="tg-mfhl">Addition of a degradation tag</td>
+    <td class="tg-mfhl">65</td>
+    <td class="tg-mfhl">GCAAACGACGAAACTACGCTTTAGTAATGATACTAGAGCGCAAAAAACCCC</td>
+  </tr>
+  <tr>
+    <td class="tg-mfhl">PPC6</td>
+    <td class="tg-mfhl">PixCell Construct</td>
+    <td class="tg-mfhl">Reverse</td>
+    <td class="tg-mfhl">Addition of a degradation tag</td>
+    <td class="tg-mfhl">65</td>
+    <td class="tg-mfhl">CTAAAGCGTAGTTTCGTCGTTTGCCTTATACAGCTCGTCCATACCGTGG<br></td>
+  </tr>
+</table>
+<ol>
+<li>PCR Reactions</li>
+<div class="underbold">SoxRS regulon Amplification</div>
+<p>The PCR was carried out using the primers PPC1 and PPC2 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 59.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.
+<li>GFP Amplification.</li>
+<p>The PCR was carried out using the primers PPC3 and PPC4 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 61.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.</p>
+<li>Gel Electrophoresis</li>
+<p>Both PCR product were run on a 1% agarose gel and extracted using the New England Biolabs gel extraction kit using the recommended protocol.</p>
+<li>Golden Gate Assembly</li>
+<p>The two amplicons were cloned into the pBR322 vector by adding 75ng of pBR322 and 30.1ng of SoxRS regulon and 23.4ng of GFP amplicon to the golden gate assembly mix (NEB, E1600S). Following the NEB protocol the mixture was incubated at 37°C for 1 hr and at 55°C, 5 mins.</p>
+<li>Transformation</li>
+<p>The PixCell construct was transformed into DJ901 and Turbo cells using the KCM heat shock protocol.</p>
+<li>Addition of the Degradation Tag</li>
+<p>Turbo cells containing the PixCell construct were grown overnight and miniprepped following the NEB protocol in order to obtain template DNA for the following PCR reaction.
+The PCR was carried out using the primers PPC5 and PPC6 and Phusion polymerase (New England Biolabs) with 3% DMSO. Following a protocol of 30 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 3 minutes, and a final extension at 72 °C for 10 minutes. These primers produce complementary overhangs which when ligated together add a degradation tag we designed to the 3’ end of the coding region of GFP.</p>
+<li>Ligation</li>
+<p>The ends of the PCR amplicon produced from the primers PPC5 and PPC6 were ligated using T4 DNA ligase (NEB) following the recommended NEB protocol.</p>
+<li>Transformation<li>
+<p>The PixCell construct with deg tag was transformed into DJ901 cells using the KCM heat shock protocol.</p>
+</div>
                  <div class="clr"></div>
              <!--End Experiment-->
@@ Line 199: / Line 321: @@
                  <!--Start Experiment 2-->
                  <div id="expt2">
-                 <h4> In-solution Electrode Testing</h4>
+                 <h4 class="underbold"> Characterizing Pixcell Constructs</h4>
                  <div onclick="expandAll('expt2p');" class="expandButton">
                      <p class="expand expt2p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 211: / Line 333: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475.
+All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background.
+Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.
+</p>
                  </div>
-                 <div type="button" class="accordion">Relevance</div>
+                 <div type="button" class="accordion">Materials</div>
                  <div class="panel expt2p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                   <ul>
+                            <li>Autoclaved LB media</li>
+                            <li>Autoclaved 10x concentated LB media</li>
+                            <li>500 mM pyocyanin stock solution (from Sigma-Aldrich, CAS: No. 86-66-5)</li>
+                            <li>125 mM potassium ferricyanide stock solution (from Sigma-Aldrich, CAS: No. 13746-66-2)</li>
+                            <li>500 mM ferrocyanide stock solution (from Sigma-Aldrich, CAS 14459-95-1 )</li>
+                            <li>20% Sodium Sulfite Solution</li>
+                            <li>
+Agar plates with colonies of E. coli DJ901 strains with respective constructs: PixCell Patterning Circuit 1 (BBa_K2862021). PixCell Patterning Circuit 2 (BBa_K2862022), negative control (DJ901 WT) and positive control (constitutively expressed GFP).</li>
+                            <li>37°C shaking incubator</li>
+                            <li>BMG Labtech FLUOstar plate reader</li>
+                            <li>4x Greiner BioOne 96-F 96-well microplate (black with clear bottom)</li>
+                            <li>14 mL culture tubes</li>
+                            <li>autoclaved eppendorfs</li>
+                        </ul>
                  </div>
-                 <div type="button" class="accordion">Brief Method</div>
+                 <div type="button" class="accordion">Notes</div>
                  <div class="panel expt2p">
-                         <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
+                         <p>Work in very sterile conditions. To prevent contaminations in the blanks, use triple antibiotics.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+</br>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+Store pyocyanin and ferrocyanide and ferricyanide solutions in the freezer until use.
+</br>
+We used 10x concentrated LB in order not to dilute nutrients at higher pyocyanin concentration; this was back diluted with autoclaved water. Mastemixes have double the working concentrations, as 100 uL of solution is then diluted with 100 uL of liquid cultures.
+                        </p>
                  </div>
-                    <div type="button" class="accordion" >Summary</div>
+                    <div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt2p">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+<ol>
+<li>Grow starter liquid cultures of cells  (Day 0, 10-15 min preparation +  overnight)</li>
+<p>Working in very sterile conditions, take 5 14mL culture tubes and prepare them according to table below: </p>
+<table class="tg">
+  <tr>
+    <th class="tg-1wig">Label</th>
+    <th class="tg-1wig"><i>E. coli</i> strain</th>
+    <th class="tg-1wig">Construct</th>
+    <th class="tg-1wig">Antibiotic  (Ab)</th>
+    <th class="tg-1wig">V Ab (uL)</th>
+    <th class="tg-1wig">V LB (mL)</th>
+  </tr>
+  <tr>
+    <td class="tg-0lax">PC1</td>
+    <td class="tg-0lax">DJ901</td>
+    <td class="tg-0lax">BBa_K2862021</td>
+    <td class="tg-096r">Kan + Amp</td>
+    <td class="tg-0lax">5 + 5</td>
+    <td class="tg-0lax">5</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">PC2</td>
+    <td class="tg-0lax">DJ901</td>
+    <td class="tg-0lax">BBa_K2862022</td>
+    <td class="tg-0lax">Kan + Amp</td>
+    <td class="tg-0lax">5 + 5</td>
+    <td class="tg-0lax">5</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">-</td>
+    <td class="tg-0lax">DJ901</td>
+    <td class="tg-0lax">none</td>
+    <td class="tg-0lax">Kan</td>
+    <td class="tg-0lax">5 </td>
+    <td class="tg-0lax">5</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">+</td>
+    <td class="tg-0lax">DJ901</td>
+    <td class="tg-0lax">GFP_Boo</td>
+    <td class="tg-0lax">Kan + Chl</td>
+    <td class="tg-0lax">5 + 5</td>
+    <td class="tg-0lax">5</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">Blanks</td>
+    <td class="tg-0lax">None</td>
+    <td class="tg-0lax">None</td>
+    <td class="tg-0lax">Kan + Amp + Chl</td>
+    <td class="tg-0lax">5 + 5</td>
+    <td class="tg-0lax">5</td>
+  </tr>
+</table>
+<p>With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator).  We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)</p>
+<li>Prepare mastermixes (30 min)</li>
+<p> Mastermixes for each redox molecule concentration  prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.</p>
+<p>Mastermizes for Day 1 and Day 2 :</p>
+<table class="tg">
+  <tr>
+    <th class="tg-s268">Condition</th>
+    <th class="tg-s268">V Pyo (uL)</th>
+    <th class="tg-s268">Kan (uL)</th>
+    <th class="tg-0lax">LB 10x uL</th>
+    <th class="tg-0lax">Autoclaved Water (uL)</th>
+    <th class="tg-0lax">Tot Vol (uL)</th>
+  </tr>
+  <tr>
+    <td class="tg-s268">A = 0 mM Pyo</td>
+    <td class="tg-s268">0</td>
+    <td class="tg-s268">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1098</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-s268">B = 0.01 mM Pyo</td>
+    <td class="tg-s268">0.0976</td>
+    <td class="tg-s268">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1097.9024</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">C = 0.025 mM Pyo</td>
+    <td class="tg-0lax">0.244</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1097.756</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">D = 0.05 uM Pyo</td>
+    <td class="tg-0lax">0.488</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1097.512</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">E = 0.1 mM Pyo</td>
+    <td class="tg-0lax">0.976</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1097.024</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">F = 0.25 mM Pyo</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1095.56</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">G = 0.5 mM Pyo</td>
+    <td class="tg-0lax">4.88</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1093.12</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">H = 1 mM Pyo</td>
+    <td class="tg-0lax">9.76</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1088.24</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+</table>
+<p>Mastermixes for Day 3 and Day 4: </p>
+<table class="tg">
+  <tr>
+    <th class="tg-s268">Condition</th>
+    <th class="tg-s268">V Pyo (uL)</th>
+    <th class="tg-s268">Kan (uL)</th>
+    <th class="tg-0lax">LB 10x uL</th>
+    <th class="tg-0lax">Autoclaved Water (uL)</th>
+    <th class="tg-0lax">Tot Vol (uL)</th>
+  </tr>
+  <tr>
+    <td class="tg-s268">A = 2.5 mM Pyo</td>
+    <td class="tg-s268">24.4</td>
+    <td class="tg-s268">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1073.6</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-s268">B = 5 mM Pyo</td>
+    <td class="tg-s268">48.8</td>
+    <td class="tg-s268">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1049.2</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">C = 10 mM Pyo</td>
+    <td class="tg-0lax">97.6</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1000.4</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">D = 25 mM Pyo</td>
+    <td class="tg-0lax">244</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">854</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">E = 50 mM Pyo</td>
+    <td class="tg-0lax">488</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">610</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+  <tr>
+    <td class="tg-0lax">F = 100 mM Pyo</td>
+    <td class="tg-0lax">976</td>
+    <td class="tg-0lax">2.44</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">122</td>
+    <td class="tg-0lax">1220</td>
+  </tr>
+</table>
+<p> We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:</p>
+<table class="tg">
+  <tr>
+    <th class="tg-xgv8">Condition</th>
+    <th class="tg-xgv8">Volume of A-H Mastermix (uL) </th>
+    <th class="tg-xgv8">Ampicillin (uL)</th>
+    <th class="tg-oyd9">Chloramphenicol (uL)</th>
+  </tr>
+  <tr>
+    <td class="tg-cify">PC1 + PC2</td>
+    <td class="tg-cify">406</td>
+    <td class="tg-cify">2.44</td>
+    <td class="tg-ksfr">0</td>
+  </tr>
+  <tr>
+    <td class="tg-cify">+</td>
+    <td class="tg-cify">203</td>
+    <td class="tg-cify">0</td>
+    <td class="tg-ksfr">2.44</td>
+  </tr>
+  <tr>
+    <td class="tg-ksfr">-</td>
+    <td class="tg-ksfr">203</td>
+    <td class="tg-ksfr">0</td>
+    <td class="tg-ksfr">0</td>
+  </tr>
+  <tr>
+    <td class="tg-ksfr">Blanks</td>
+    <td class="tg-ksfr">406</td>
+    <td class="tg-ksfr">2.44</td>
+    <td class="tg-ksfr">2.44</td>
+  </tr>
+</table>
+This gave a total of 32 eppendorf tubes for Day 1 and 24 on Day 2, ready to be transferred into 96-well plates.
+<li>Fill 96-well plate with media solutions</li>
+<p>Add 100 uL of media in the desired wells, according following the label on mastermixes and table below: </p>
+<table class="tg">
+  <tr>
+    <th class="tg-0pky"></th>
+    <th class="tg-fymr">1</th>
+    <th class="tg-fymr">2</th>
+    <th class="tg-fymr">3</th>
+    <th class="tg-fymr">4</th>
+    <th class="tg-fymr">5</th>
+    <th class="tg-fymr">6</th>
+    <th class="tg-fymr">7</th>
+    <th class="tg-fymr">8</th>
+    <th class="tg-fymr">9</th>
+    <th class="tg-fymr">10</th>
+    <th class="tg-fymr">11</th>
+    <th class="tg-fymr">12</th>
+  </tr>
+  <tr>
+    <td class="tg-fymr">A</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BA</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BA</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BA</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BA</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">B</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BB</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BB</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BB</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BB</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">C</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BC</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BC</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BC</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BC</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">D</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BD</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BD</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BD</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BD</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">E</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BE</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BE</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BE</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BE</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">F</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BF</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BF</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BF</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BF</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">G</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BG</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BG</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BG</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BG</td>
+  </tr>
+  <tr>
+    <td class="tg-fymr">H</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-cai3">PC1</td>
+    <td class="tg-0pky">BH</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-f14n">PC2</td>
+    <td class="tg-0pky">BH</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-xuin">-</td>
+    <td class="tg-0pky">BH</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-r3a5">+</td>
+    <td class="tg-0pky">BH</td>
+  </tr>
+</table>
+<li>OD600 matching</li>
+<p>After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL</p>
+<p>Cell dilution calculator:
+Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells
+E.g. to dilute 5mL of cells at an OD600 of 0.3 to OD of 0.1 = [ (5mL*0.3)/0.1 - 5]  =10 mL
+</p>
+<li>Add cells to 96-well plate</li>
+<p>We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.</p>
+<li>Set up the script in the plate reader and start experiment</li>
+<p>For Pyocyanin experiments:</p>
+<p>We set up a script on the BMG Labtech Omega control software to perform endpoint  absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200.  </p>
+<li>Data analysis</li>
+<p>We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments  </p>
+</ol>
                  </div>
                  <div class="clr"></div>
@@ Line 237: / Line 767: @@
                  <!--Start Experiment 3-->
                  <div id="expt3"></div>
-                 <h4 > On-agar Electrode Testing</h4>
+                 <h4 class="underbold"> Electrochemistry of Redox Modulators</h4>
                  <div onclick="expandAll('expt3p');" class="expandButton">
                      <p class="expand expt3p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 249: / Line 779: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>Protocol for cyclic voltammetry and amperommetry experiments
-                </div>
+</p>
-                <div type="button" class="accordion">Relevance</div>
-                <div class="panel expt3p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
                  </div>
-                 <div type="button" class="accordion">Brief Method</div>
+                 <div type="button" class="accordion">Notes</div>
                  <div class="panel expt3p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
                  </div>
-                 <div type="button" class="accordion" >Summary</div>
+                 <div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt3p">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <ol><li>Square-wave voltammetry was obtained with the setup descripted in the results section.</li> <li>Solutions in the flask containing the reference and working electrode were identical to the solutions in the respective flasks containing the counter electrode.</li>
+<li>Square-wave voltammetry was performed with the PalmSens 4-channel MultiEmStat3 between -0.3 and +0.5 Volt.</li>
+<li> The counter electrodes contained 60% Carbon with a diameter of 5mm. Working electrodes contained 90% Carbon with a 2mm diameter. Salt bridges were consists of 3% agar containing 1 molar potassium chloride inside plastic tubing. The reference electrode was produced by placing a silver wire within 3% agar containing 3 molar potassium chloride inside plastic tubing. </li>
+<li>Square wave voltammetry was performed with the following treatment settings: 10s equilibrium time, voltage step of 0.005V, amplitude 0.05V, frequency 25 Hz, the voltage beginning at -0.3V and ending at 0.5V.</li>
+<li>Amperometry was performed in  a plate containing the final conditions: 10mM FCN(R), 2.5 uM Pyocyanin, 0.02% Sulfite, Ampicillin, Kanamycin and cells containing the PixCell construct with the following treatment settings: 10sec equilibrium time, time interval 0.05s run time up to 65000 seconds, V=+0.5. </li>
                  </div>
                  <div class="clr"></div>
@@ Line 276: / Line 804: @@
                  <!--Start Experiment 4-->
                  <div id="expt4"></div>
-                 <h4 > 1-State Expression In-solution</h4>
+                 <h4 class="underbold"> Spatial Electronic Control of Gene Induction</h4>
                  <div onclick="expandAll('expt4p');" class="expandButton">
                      <p class="expand expt4p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 288: / Line 816: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>Given that we had determined the voltage by which pyocynanin becomes oxidised, we replicated that oxidation within a plate. Thereby turning on GFP expression by oxidising SoxR indirectly.</p>
-                </div>
-                <div type="button" class="accordion">Relevance</div>
-                <div class="panel expt4p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
                  </div>
-                <div type="button" class="accordion">Brief Method</div>
-                <div class="panel expt4p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                 <div type="button" class="accordion" >Summary</div>
+                 <div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt4p">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <ol><li>Three 5mm holes were drilled into 9cm agar plates. Working, counter reference electrodes were prepared as described in the results section.</li>
+<li> Electrodes were inserted into the plate penetrating 2mm and glued to the plate.</li>
+<li> Solutions containing 10mM FCN(R), 2.5 mM Pyocyanin, 0.3% Sulfite, Ampicillin and Kanamycin were pitpetted into a 50ml falcon tube. </li>
+<li> 50ml of molten 1% agar was added to the falcon tube. Shaking ensured that the solution was well mixed. After mixing 22ml of the solution was pipetted onto the agar plate. </li>
+<li> It was ensured that agar covered the electrodes fully. </li>
+<li> After the agar was set, 100uL of cells containing the PixCell construct Deg Tag at an OD of 0.3. were plated onto the agar. </li>
+<li>Afterwards the plate was turned upside down, closed and sealed using tape. The setup was then placed into a 37°C incubator.<li/>
+<li> Potentials were then applied overnight for 13h as described here. </li>
+<li>To investigate fluorescence the agar was transferred onto a fresh plate without electrodes penetrating from the bottom. Fluorescence was measured using the Fujifilm FLA-5000 Fluorescent Image Analyser on the following settings: Laser wavelength: 250nm, filter: FITC, gradation: 65536 (16bit), resolution: 50uM. Images where then imported into imageJ for image analysis. Minimum brightness was set to 13867 in all images to discard small fluorescence values which correspond to background fluorescence. </li>
+</ol>
                  </div>
                  <div class="clr"></div>
@@ Line 312: / Line 838: @@
-                <!--Start Experiment 5-->
+                  <!--Start Experiment 5-->
                  <div id="expt5"></div>
-                 <h4> 1-State Expression On-Agar</h4>
+                 <h4  class="underbold" >Creating the Sox Library</h4>
                  <div onclick="expandAll('expt5p');" class="expandButton">
                      <p class="expand expt5p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
                      <div class="expand" style="margin-right:5px;">
-                          <i class="fa fa-angle-double-down expt5p"></i>
+                        <i class="fa fa-angle-double-down expt5p"></i>
                      </div>
                  </div>
@@ Line 326: / Line 852: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+              <p> This protocol describes how to create a library of constructs varying two parts using BASIC assembly method. Following it we constructed a 48 constructs library, using 3 repeated parts and a variable promoter (pSoxS) with 8 variants, and a variable transcription factor (SoxR) with 6 variants (one of them unsubmitted to registry). </p>
                  </div>
-                 <div type="button" class="accordion">Relevance</div>
+                 <div type="button" class="accordion">Notes</div>
                  <div class="panel expt5p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                        <p>
+All the experiments for this part of the project were performed on E. coli DH5α, origin strain for DJ901, as this last one could not be made super-competent (109 cfu / μg pUC19  DNA) enough to transform BASIC assembly products. Individual parts were integrated in chloramphenicol resistant high copy plasmid pSB1C3_BASIC vectors and assemblies were performed in ampicillin resistant mid copy plasmid p15A vectors. All individual parts were synthesised and ordered as gblocks with BASIC prefix and suffix through IDT. The linkers used were provided by Biolegio and the adaptors were courtesy of Dr. Baldwin’s lab at Imperial College London.
+</p>
+<style type="text/css">
+.tg  {border-collapse:collapse;border-spacing:0;}
+.tg td{font-family:Arial, sans-serif;font-size:12px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;}
+.tg th{font-family:Arial, sans-serif;font-size:12px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;}
+.tg .tg-u4ur{background-color:#ffcc67;text-align:left;vertical-align:top}
+.tg .tg-m9r4{background-color:#ffffc7;text-align:left;vertical-align:top}
+</style>
+<table class="tg">
+  <tr>
+    <th class="tg-u4ur">Construct name</th>
+    <th class="tg-u4ur">Promoter (pSoxS)</th>
+    <th class="tg-u4ur">Transcription factor (SoxR)</th>
+    <th class="tg-u4ur">Plasmid</th>
+    <th class="tg-u4ur">Constitutive promoter</th>
+    <th class="tg-u4ur">GFP</th>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A1</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A2</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A3</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A4</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A5</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_A6</td>
+    <td class="tg-m9r4">BBa_K2862006</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B1</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B2</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B3</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B4</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B5</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_B6</td>
+    <td class="tg-m9r4">BBa_K2862007</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C1</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C2</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C3</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C4</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C5</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_C6</td>
+    <td class="tg-m9r4">BBa_K2862008</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D1</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D2</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D3</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D4</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D5</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_D6</td>
+    <td class="tg-m9r4">BBa_K2862009</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E1</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E2</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E3</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E4</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E5</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_E6</td>
+    <td class="tg-m9r4">BBa_K2862010</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F1</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F2</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F3</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F4</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F5</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_F6</td>
+    <td class="tg-m9r4">BBa_K2862011</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G1</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G2</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G3</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G4</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G5</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_G6</td>
+    <td class="tg-m9r4">BBa_K2862012</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H1</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">BBa_K2862014</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H2</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">BBa_K2862015</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H3</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">BBa_K2862016</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H4</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">BBa_K2862017</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H5</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">BBa_K2862018</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+  <tr>
+    <td class="tg-m9r4">PC_H6</td>
+    <td class="tg-m9r4">BBa_K2862013</td>
+    <td class="tg-m9r4">SoxR-8 (not submitted)*</td>
+    <td class="tg-m9r4">P15A-Amp</td>
+    <td class="tg-m9r4">BBa_K2862019</td>
+    <td class="tg-m9r4">Yes</td>
+  </tr>
+</table>
+ <div class="caption">
+            <p><b>Figure 1.</b> Table showing assembly parts combinations. RBS for GFP and SoxR were in the linker oligo, being RBS3 the one used for both GFP and SoxR. </p>
+<p>*As SoxR-8 was original from C.amalonaticus a predicted human pathogen, we did not
+submit that part to the registry, however we worked with it because of its interesting
+properties.</p>
                  </div>
+</div>
-                <div type="button" class="accordion">Brief Method</div>
+<div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt5p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
+                    <p>Parts assembly for library generation was performed as described in Storch, Casini et al.,
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+. Briefly, linkers were prepared adding 49 µl of annealing buffer (
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+mM TRIS-HCl buffer pH7.9, 100mM NaCl, 10mM MgCl2 ) to 0.5 µl (1 µM) of linker and
-                </div>
+.5 µl (1 µM) of adapter oligos, and incubating at 95ºC for 1 min. Once linkers were ready
+they were mixed with the parts for the digestion/ligation reaction and incubated at 37ºC for
+hour, 20ºC for 20 min, 65ºC for 20 min. Each 30 µl reaction had 3µl of ATP, 3µl of NEB4,
-                <div type="button" class="accordion" >Summary</div>
+µl BSA, 5µl of prefix linker (1µM), 5µl of suffix linker (1 µM), 1µl of BsaI (20 U/µl), 0.5 µl of
-                <div class="panel expt5p">
+T4 ligase (400 U/µl), 1µl DNA part (200 ng/µl) and water. Parts and linkers
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+were mixed according to the following table.</p>
-                </div>
+<style type="text/css">
+.tg  {border-collapse:collapse;border-spacing:0;}
+.tg td{font-family:Arial, sans-serif;font-size:12px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;}
+.tg th{font-family:Arial, sans-serif;font-size:12px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;}
+.tg .tg-kftd{background-color:#efefef;text-align:left;vertical-align:top}
+.tg .tg-m9r4{background-color:#ffffc7;text-align:left;vertical-align:top}
+</style>
+<table class="tg">
+  <tr>
+    <td class="tg-kftd">Part</td>
+    <td class="tg-m9r4">Promoter (for all 8 pSoxS)</td>
+    <td class="tg-m9r4">Transcription factor (for all 6 SoxR)</td>
+    <td class="tg-m9r4">Plasmid (p15A)</td>
+    <td class="tg-m9r4">Constitutive promoter (Pfam2-J23101)</td>
+    <td class="tg-m9r4">GFP</td>
+  </tr>
+  <tr>
+    <td class="tg-kftd">Linker prefix</td>
+    <td class="tg-m9r4">LMP</td>
+    <td class="tg-m9r4">UTR2-3</td>
+    <td class="tg-m9r4">LMS</td>
+    <td class="tg-m9r4">L5</td>
+    <td class="tg-m9r4">UTR1-3</td>
+  </tr>
+  <tr>
+    <td class="tg-kftd">Linker suffix</td>
+    <td class="tg-m9r4">UTR1-3</td>
+    <td class="tg-m9r4">LMS</td>
+    <td class="tg-m9r4">LMP</td>
+    <td class="tg-m9r4">UTR2-3</td>
+    <td class="tg-m9r4">L5</td>
+  </tr>
+</table>
+ <div class="caption">
+            <p><b>Figure 2.</b> Linkers added to each part for assembly (linker notation is based on Stoch et al. 2015 analyzed linker data)</p>
+<p>Digested parts were purified using Magbead purification in a AMPure XP magnetic
+purification kit according to manufacturer’s recommendations (Beckman Coulter). These
+were then assembled in 48 different combinations, to form our 48 different library
+constructs. Each 10vl assembly reaction contained 1µl of each purified DNA part with
+linkers, 1µl of NEB4 and 1µl of BSA. Assembly was performed incubating the mix at 50ºC for
+min.</p>
+</div>
+</div>
                  <div class="clr"></div>
              <!--End Experiment-->
                  <!--Start Experiment 6-->
                  <div id="expt6"></div>
-                 <h4> 2-State Construct Assembly</h4>
+                 <h4 class="underbold"> Characterising the Sox Library</h4>
                  <div onclick="expandAll('expt6p');" class="expandButton">
                      <p class="expand expt5p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 365: / Line 1,347: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>The 48 parts library was characterised using the same procedures described for Pixcell construct characterisation (see previous protocol). The only difference is that instead of analysing each construct with 14 different inducer conscentrations we only analysed the base construct PC_A1. Then we characterised the other 47 constructs with only 3 inducer concentrations and fitted this data onto the sigmoidal curve created by PC_A1.</p>
                  </div>
-                 <div type="button" class="accordion">Relevance</div>
+                 <div type="button" class="accordion">Notes</div>
-                <div class="panel expt6p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div type="button" class="accordion">Brief Method</div>
                  <div class="panel expt6p">
-                         <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
+                         <p>We determined that PC_A1 is our base construct as it is Pixcell construct in library format. This means that it has the same transcription factor (SoxR-0) and the same promoter (pSoxS-0) only that this one in Pfam1 promoter architecture. Therefore, this construct should give us the most similar results to Pixcell construct and show the effect of library architecture. </p>
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
                  </div>
-                 <div type="button" class="accordion" >Summary</div>
+                 <div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt6p">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+<p><b>Promoter induction assay</b></p>
+                     <p>The best colonies from each succesful construct were characterised in an induction assay
+with pyocyanin. Assays were performed with different concentrations of pyocyanin (0-100
+µM) and 100 µl of OD 0.1 cells in BMG Clariostat plate readers at 30º C.
+<p><b>Part growth assay</b></p>
+As some constructs did not grow any succesful colony we performed toxicity assays with the
+individual parts. Each part in pSB1C3-BASIC was transformed into E.coli DH5α strains using
+NEB high efficiency transformation protocol (C2987H/C2987I). Then succesful transformants
+were grown at 37ºC for 24 hours in a shaking BMG Clariostat plate reader and OD600
+measurements were taken every 10min (see previous protocol in Pixcell construct characterization).</p>
                  </div>
                  <div class="clr"></div>
@@ Line 390: / Line 1,376: @@
                  <!--Start Experiment 7-->
                  <div id="expt7"></div>
-                 <h4 > 2-State Expression In-solution</h4>
+                 <h4 class="underbold"> Biocontainment- Gp2 Growth Inhibition</h4>
                  <div onclick="expandAll('expt7p');" class="expandButton">
                      <p class="expand expt7p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
@@ Line 404: / Line 1,391: @@
                  <div type="button" class="accordion"> Description </div>
                  <div class="description">
-                     <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>A biocontainment device to prototype one of our proposed applications. By placing this downstream of pSoxS we could inhibit cell growth in the oxidising conditions we can produce from our electrochemical set up. We envision this being used with our array in a biocontainment device in which any cells that spread to the edges of the device have their growth seized by an oxidising potential. This device could be used to prevent the accidental release of GMOs, much like how electric fences are used to restrain animals.</p>
                  </div>
-                 <div type="button" class="accordion">Relevance</div>
+                 <div type="button" class="accordion" >Procedure</div>
                  <div class="panel expt7p">
-                     <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
+                     <p>Constructs were assembled by BASIC assembly into a low-copy number pSC101 backbone. SoxR was placed under the control of a medium strength RBS whereas Gp2 was constructed with an RBS library. Both RBSs were located within the BASIC linker sequences. Following assembly transformed cells were plated on LB-agar containing 10mM ferrocyanide and 0.02% sodium sulfite. Five biological replicates seeded from a single colony for each construct were grown out in LB containing 10mM ferrocyanide and 0.02% sodium sulfite for 6 hours. These cultures were then diluted to a final OD of 0.1. 5μl of each culture was added to 195μl LB solutions in a Greiner BioOne F-bottom 96-well plates to a final concentration of 2.5μl pyocyanin, 10mM ferricyanide and 0.02% sulfite for the OFF condition and to 2.5μl pyocyanin, 10mM ferrocyanide and 0.02% sulfite for the ON condition. Plates were incubated for 24 hours in a BMG Labtech FLUOstar at 37oC with absorbance readings at 600nm every 5 minutes.</p>
-                </div>
-                <div type="button" class="accordion">Brief Method</div>
-                <div class="panel expt7p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div type="button" class="accordion" >Summary</div>
-                <div class="panel expt7p">
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
                  </div>
                  <div class="clr"></div>
              <!--End Experiment-->
-                <!--Start Experiment 8-->
-                <div id="expt8"></div>
-                <h4 > 2-State Expression On-agar</h4>
-                <div onclick="expandAll('expt8p');" class="expandButton">
-                    <p class="expand expt8p colorChange" style="font-size:25px;padding-top:1px;" >Access All</p>
-                    <div class="expand" style="margin-right:5px;">
-                          <i class="fa fa-angle-double-down expt8p"></i>
-                    </div>
-                </div>
-                <div class="clr"></div>
-                <div type="button" class="accordion"> Description </div>
-                <div class="description">
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div type="button" class="accordion">Relevance</div>
-                <div class="panel expt8p">
-                    <p >Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div type="button" class="accordion">Brief Method</div>
-                <div class="panel expt8p">
-                        <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.
-                        Lorem ipsum dolor, sit amet consectetur adipisicing elit. <a href="#" class="highlight">Competant cell protocol</a> Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                        <p>Lorem ipsum dolor, sit amet <a href="#" class="highlight">Heatshock protocol</a> consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div type="button" class="accordion" >Summary</div>
-                <div class="panel expt8p">
-                    <p>Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.</p>
-                </div>
-                <div class="clr"></div>
-            <!--End Experiment-->
                      <script>

	1	2	3	4	5	6	7	8	9	10	11	12
A	PC1	PC1	BA	PC2	PC2	BA	-	-	BA	+	+	BA
B	PC1	PC1	BB	PC2	PC2	BB	-	-	BB	+	+	BB
C	PC1	PC1	BC	PC2	PC2	BC	-	-	BC	+	+	BC
D	PC1	PC1	BD	PC2	PC2	BD	-	-	BD	+	+	BD
E	PC1	PC1	BE	PC2	PC2	BE	-	-	BE	+	+	BE
F	PC1	PC1	BF	PC2	PC2	BF	-	-	BF	+	+	BF
G	PC1	PC1	BG	PC2	PC2	BG	-	-	BG	+	+	BG
H	PC1	PC1	BH	PC2	PC2	BH	-	-	BH	+	+	BH

	1	2	3	4	5	6	7	8	9	10	11	12
A	PC1	PC1	BA	PC2	PC2	BA	-	-	BA	+	+	BA
B	PC1	PC1	BB	PC2	PC2	BB	-	-	BB	+	+	BB
C	PC1	PC1	BC	PC2	PC2	BC	-	-	BC	+	+	BC
D	PC1	PC1	BD	PC2	PC2	BD	-	-	BD	+	+	BD
E	PC1	PC1	BE	PC2	PC2	BE	-	-	BE	+	+	BE
F	PC1	PC1	BF	PC2	PC2	BF	-	-	BF	+	+	BF
G	PC1	PC1	BG	PC2	PC2	BG	-	-	BG	+	+	BG
H	PC1	PC1	BH	PC2	PC2	BH	-	-	BH	+	+	BH

	1	2	3	4	5	6	7	8	9	10	11	12
A	PC1	PC1	BA	PC2	PC2	BA	-	-	BA	+	+	BA
B	PC1	PC1	BB	PC2	PC2	BB	-	-	BB	+	+	BB
C	PC1	PC1	BC	PC2	PC2	BC	-	-	BC	+	+	BC
D	PC1	PC1	BD	PC2	PC2	BD	-	-	BD	+	+	BD
E	PC1	PC1	BE	PC2	PC2	BE	-	-	BE	+	+	BE
F	PC1	PC1	BF	PC2	PC2	BF	-	-	BF	+	+	BF
G	PC1	PC1	BG	PC2	PC2	BG	-	-	BG	+	+	BG
H	PC1	PC1	BH	PC2	PC2	BH	-	-	BH	+	+	BH