(47 intermediate revisions by 3 users not shown) | |||
Line 47: | Line 47: | ||
</head> | </head> | ||
− | <body> | + | <body style="height:100%;"> |
Line 57: | Line 57: | ||
<li class="side_list"> | <li class="side_list"> | ||
− | <a href="#abstract"> | + | <a href="#abstract">Short summary</a> |
</li> | </li> | ||
<li class="side_list"> | <li class="side_list"> | ||
− | <a href="#intro"> | + | <a href="#intro">The Tace system</a> |
</li> | </li> | ||
<li class="side_list"> | <li class="side_list"> | ||
Line 77: | Line 77: | ||
<div class="main_content"> | <div class="main_content"> | ||
− | <div class="title"> | + | <div class="title">Silencing Results</div> |
− | + | ||
<article> | <article> | ||
Line 84: | Line 83: | ||
</article> | </article> | ||
<a name="abstract" id="abstract" class="shifted-anchor"></a> | <a name="abstract" id="abstract" class="shifted-anchor"></a> | ||
− | <h2> | + | <h2>Short summary</h2> |
<article> | <article> | ||
− | We designed and build a two-vector system to express and test siRNAs using homologe | + | We designed and build a two-vector system to express and test siRNAs using the homologe <i>Escherichia coli</i> proteins Hfq, RppH and RNase E. Because of major difficulties during this process we had not enough time to test the system extensively. The system is designed to test multiple siRNAs in high throughout mode and offers expression vectors with integrated RNA sequences that can be used to add additional functionalities to an siRNA. Two generations of target vectors were designed. See how to apply the Tace system to your project below. |
</article> | </article> | ||
Line 94: | Line 93: | ||
<a name="abstract" id="intro" class="shifted-anchor"></a> | <a name="abstract" id="intro" class="shifted-anchor"></a> | ||
− | <h2> | + | <h2>The Tace system</h2> |
<article> | <article> | ||
− | RNA interference (RNAi) is a largely used alternative to other known knock-out-systems like CRISPR/Cas. That is why we established an easy-to-use siRNA-system for iGEM. Due to the fact that it is complicated and expensive to run multiple RNA quantification and RNA purification experiments we constructed a vector-system, TACE, to express and validate different siRNAs in vivo. The whole system is designed to test several siRNAs with a high sample throughput to select the perfect siRNA for the specific knock | + | RNA interference (RNAi) is a largely used alternative to other known knock-out-systems like CRISPR/Cas. That is why we established an easy-to-use siRNA-system for iGEM. Due to the fact that it is complicated and expensive to run multiple RNA quantification and RNA purification experiments we constructed a vector-system, TACE, to express and validate different siRNAs in vivo. The whole system is designed to test several siRNAs with a high sample throughput to select the perfect siRNA for the specific knock down. There are several possibilities to adapt the siRNA to personal needs like overlaps or different additions. For an easier design of the perfect siRNA we created an <a href =" https://2018.igem.org/Team:Bielefeld-CeBiTec/Software"> siRNA constructor (siRCon)</a> which is able to construct the best siRNA for every target gene. |
</article> | </article> | ||
− | <article> | + | <div class="article"> |
We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA. | We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA. | ||
− | It is important to make all expressed siRNAs comparable to each other. Therefore we designed four | + | It is important to make all expressed siRNAs comparable to each other. Therefore we designed four BioBricks featuring the same promoter to establish the same expression rate for all siRNAs. As a first generation, we designed the four BioBricks <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>, <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a>, <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a> and <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a> (Figure 1-4) for our expression vectors. They contain a Golden Gate Assembly (GGA) cassette which can be cut out using the restriction enzyme <i>Bbs</i>I. So it is possible to replace the whole GGA cassette with a specific siRNA with the usage of our <a href="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">GGA protocol</a>. The transcription of the siRNA is terminated by the strong Terminator <a href="http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a> to make sure that all expression processes are completely terminated. |
− | While the | + | While the BioBrick <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>(Figure 1) is supposed to transcribe an siRNA without further modifications, the BioBrick <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a> (Figure 2) also includes the Hfq binding sequence originating of the MicC-siRNA (Chen <i>et al.</i>, 2004). The BioBrick <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a> (Figure 3) contains the 5’-UTR from ompA as a protective sequence upstream of the siRNA insertion site and the BioBrick <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a> (Figure 4) with both features surrounding the insertion site as well as sequences combined to add further functions to the siRNA. |
− | </ | + | </div> |
<figure role="group"> | <figure role="group"> | ||
− | <img class="figure | + | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/3/3e/T--Bielefeld-CeBiTec--ALE-pGuide_V2_Genkarte.png"> |
<figcaption> | <figcaption> | ||
− | <b>Figure 1:</b> Illustration of | + | <b>Figure 1:</b> Illustration of BioBrick <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>, an expression Vector for siRNAs. The BioBrick includes a Golden Gate cassette which can be cut out using the <i>BbsI</i> restriction enzyme to seamlessly fuse an siRNA into the Vector.</b> |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
<figure role="group"> | <figure role="group"> | ||
− | <img class="figure | + | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/b/b4/T--Bielefeld-CeBiTec--ALE-pGuide-Hfq_V2.png"> |
<figcaption> | <figcaption> | ||
− | <b>Figure 2:</b> Illustration of | + | <b>Figure 2:</b> Illustration of BioBrick <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a>, an expression Vector for siRNAs. The BioBrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA to the Hfq binding Sequence inside the expression Vector. |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 125: | Line 124: | ||
<figure role="group"> | <figure role="group"> | ||
− | <img class="figure | + | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/7/77/T--Bielefeld-CeBiTec--ALE-pGuide_OmpA_V2.png"> |
<figcaption> | <figcaption> | ||
− | <b>Figure 3:</b> Illustration of | + | <b>Figure 3:</b> Illustration of BioBrick <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a>, an expression Vector for siRNAs. The BioBrick includes a golden Gate Cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (5’ UTR) upstream of the site of insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation. |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
<figure role="group"> | <figure role="group"> | ||
− | <img class="figure | + | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/7/7d/T--Bielefeld-CeBiTec--ALE-pGuide_OmpA_Hfq_V2.png"> |
<figcaption> | <figcaption> | ||
− | <b>Figure 4:</b> Illustration of | + | <b>Figure 4:</b> Illustration of BioBrick <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a>, an expression Vector for siRNAs. The BioBrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (UTR)upstream, and the Hfq binding Sequence downstream of the site of siRNA insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation. |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
− | <article> | + | <div class="article"> |
− | Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The | + | Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The second part of our TACE system is a target vector, pTale, which transcribes one specific mRNA. The chosen mRNA should be silenced by the constructed siRNAs using one of the described BioBricks above. To get the optimal conditions for measuring the silencing effect of our siRNA we scheduled and constructed two generations of target vectors. For the first generation of the target vectors we used two different Reporter Proteins: the chromoprotein <a href="http://parts.igem.org/Part:BBa_K292009">AmilCp</a> (BBa_K592009) and the blue fluorescent protein <a href="http://parts.igem.org/Part:BBa_K592100">BFP</a> (BBa_K592100). Additionaly feature the target BioBrick a linker between the GGA cassette and the reporter protein. This way, the inserted target mRNA forms a CDS fusion with the reporter protein without losing any function. If the mRNA is destroyed, no reporter protein is formed. This results in no measurement of the BFP fluorescents which is proportional to the silencing strength of the siRNA. The Target Vectors were cloned with 4 different linkers (<a href="http://parts.igem.org/Part:BBa_K2638721">GGGGS, BBa_K2638721</a>; <a href="http://parts.igem.org/Part:BBa_K2638722">EAAAK, BBa_K2638722<(a>; <a href="http://parts.igem.org/Part:BBa_K2638723">XP, BBa_K2638723</a>; <a href="http://parts.igem.org/Part:BBa_K2638724">cMyc, BBa_K2638724</a>), so users of this System can choose the perfect linker for their own system. The structure of the first generation of pTale is shown in Figure 5. |
− | </ | + | </div> |
Line 146: | Line 145: | ||
<img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/0a/T--Bielefeld-CeBiTec--ALE-pTale_V1.png"> | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/0a/T--Bielefeld-CeBiTec--ALE-pTale_V1.png"> | ||
<figcaption> | <figcaption> | ||
− | <b>Figure 5:</b> Structure of the first generationof the target vector pTale. Four different Linkers were cloned. BFP and AmilCP were tested as Reporter Proteins. The Golden Gate Cassette, the Linker and the reporter protein form a fused unit and do not contain | + | <b>Figure 5:</b> Structure of the first generationof the target vector pTale. Four different Linkers were cloned. BFP and AmilCP were tested as Reporter Proteins. The Golden Gate Cassette, the Linker and the reporter protein form a fused unit and do not contain BioBrick scars. |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
<article> | <article> | ||
− | While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. | + | While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. This construct prevents false positive results generated by non-functional reporter proteins, as the fluorescence increases with higher silencing activity instead of decreasing with higher silencing effectivity. |
</article> | </article> | ||
Line 162: | Line 161: | ||
</figure> | </figure> | ||
− | + | <article> | |
+ | </article> | ||
+ | |||
+ | |||
+ | <article> | ||
+ | All Vectors with corresponding linkers and reporter proteins can be found in Table 1: | ||
+ | </article> | ||
<table id="t01" class="centern"> | <table id="t01" class="centern"> | ||
<caption class="table_caption"> <b>Table 1: </b>List of Expression vectors (pGuide) and target vectors (pTale) that were constructed in this project and their corresponding linkers, reporter proteins and other features.</caption> | <caption class="table_caption"> <b>Table 1: </b>List of Expression vectors (pGuide) and target vectors (pTale) that were constructed in this project and their corresponding linkers, reporter proteins and other features.</caption> | ||
<tr> | <tr> | ||
− | <th> | + | <th>BioBrick number </th> |
<th>Tag </th> | <th>Tag </th> | ||
<th>Linker </th> | <th>Linker </th> | ||
Line 293: | Line 298: | ||
<article> | <article> | ||
− | As we had great difficulties to assemble the vectors, we had very little time left to test the system. Amongst other small hinderances, major faults in IDT gene syntheses were the cause of great time losses. In the | + | As we had great difficulties to assemble the vectors, we had very little time left to test the system. Amongst other small hinderances, major faults in IDT gene syntheses were the cause of great time losses. In the end we were able to assemble and transform all vectors belonging to the system. |
+ | We were able to test the Target vectors cloning GFP as a target sequence into all target vectors. The OD600 and the fluorescence of BFG and GFP were measured in 96 well plates as described in the usage Protocol below using a Teacon reader. 3 replicates were measured for each sample. The results of the measurement of pTale1_B_CM are in figures 7 and 8 shown below. Two clones were tested, one of them showing expression of BFP, and one showing expression of GFP. No clones expressing both proteins were detected | ||
+ | |||
</article> | </article> | ||
+ | |||
+ | <figure role="group"> | ||
+ | <img class="figure eighty" src="https://static.igem.org/mediawiki/2018/d/d4/T--Bielefeld-CeBiTec--ALE-Vectortest_T1B_BFP.png"> | ||
+ | <figcaption> | ||
+ | <b> Figure 7:</b> Meassurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that only 50 BP of GFB were inserted as target sequence. | ||
+ | </figcaption> | ||
+ | </figure> | ||
+ | <figure role="group"> | ||
+ | <img class="figure eighty" src="https://static.igem.org/mediawiki/2018/5/5d/T--Bielefeld-CeBiTec--ALE-Vectortest_T1B_GFP_V1.png"> | ||
+ | <figcaption> | ||
+ | <b> Figure 8:</b> Measurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that a complete GFB was inserted as target sequence. | ||
+ | </figcaption> | ||
+ | </figure> | ||
+ | |||
+ | <div class="article"> | ||
+ | The results presented in figures 7 and 8 show that the cells were growing very slowly in the 12 h of measurement time owing to the oxygen limited culture conditions in the 96 well plate used. In Figure 7 a significant increase in the Fluorescence of BFP was visible, but no noteworthy increase in the Fluorescence signal of GFP was detectable. Sequencing showed that only 50 BP of the GFP were inserted into the Target vector, explaining the missing fluorescence signal. Though it could not be shown that our system works with larger protein fusions, we were able to show that our vector works as expected with short target sequences. Vice versa, in Figure 8 a strong GFP signal was detectable, while no BFP was produced. Possibly the larger GFP protein keeps the BFP from folding correctly or inhibits the fluorophore formation in another way. Both figures show a strong increase in Fluorescence upon induction with ahTc. This confirms that the strain is producing the TetR repressor, but not on a level that is high enough to repress the promotor. Possibly the copy number of pSb1C3 proved to be too high, so that not enough TetR was abundant. <br> | ||
+ | Next, we tried to clone the Guide vectors into competent cells containing the target vectors shown above. As the cells were constantly expressing GFP, we were not able to perform the blue white screening following the Golden Gate Assembly, and therefore were not able to test the pTale vectors in combination with the pGuide vectors. We were however able to clone the pGuide BioBricks into a pSB1K3 plasmid which had its native origin of replication (ori) replaced with a synthetic one (<a href="http://parts.igem.org/Part:BBa_K2638751">BBa_K2638751</a>) made from parts of Team Vilnius 2017. We were able to grow cells containing that vector and sequence the ori. <br> | ||
+ | As we ran out of time, we were not able to perform further tests on these vectors. | ||
+ | </div> | ||
Line 305: | Line 331: | ||
<img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/01/T--Bielefeld-CeBiTec--ALE-siRNA_Testsystem_Übersichtsgrafik_2.png"> | <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/01/T--Bielefeld-CeBiTec--ALE-siRNA_Testsystem_Übersichtsgrafik_2.png"> | ||
<figcaption> | <figcaption> | ||
− | <b>Figure | + | <b>Figure 9:</b> Schematic overview that shows how to use our siRNA Testing System.</b> |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 314: | Line 340: | ||
<ol type="1"> | <ol type="1"> | ||
<li> | <li> | ||
− | Prepare | + | Prepare BioBricks<br> |
− | To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore, the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of <a href="https://2017.igem.org/Team:Vilnius-Lithuania">iGEM Vilnius 2017</a> are extremely useful for this purpose. | + | To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore, the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of <a href="https://2017.igem.org/Team:Vilnius-Lithuania">iGEM Vilnius 2017</a> are extremely useful for this purpose. |
</li> | </li> | ||
− | <li> | + | <li> <br> |
Preparation of the target sequences <br> | Preparation of the target sequences <br> | ||
Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence. | Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence. | ||
<ul> | <ul> | ||
− | There are two ways to clone a target sequence into a target vector: | + | There are two ways to clone a target sequence into a target vector: |
<li>By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.</li> | <li>By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.</li> | ||
− | <li> | + | <li>By Golden Gate assembly: Specially suitable for short target sequences which can be ordered as oligonucleotides, as overlaps of 4 nucleotides are needed to assemble the vector. Dimerize the oligos by<a href="https://static.igem.org/mediawiki/2018/f/f7/T--Bielefeld-CeBiTec--ssDNA_Annealing_LK.pdf"> Oligo Annealing</a> and perform the <a href="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate assembly</a> as described in our protocols. This might be useful when only a fragment of a coding sequence is used as a target sequence.</li> |
− | </ | + | </ul> |
− | + | ||
<ul> | <ul> | ||
Line 338: | Line 363: | ||
</li> | </li> | ||
− | <li> | + | <li><br> |
− | Design siRNAs | + | Design siRNAs <br> |
<ul> | <ul> | ||
− | <li>Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the pGuide_Omp vector ( | + | <li>Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the <a href="http://parts.igem.org/Part:BBa_K2638758">pGuide_Omp vector</a> ( <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a>), as the OmpA 5-UTR significantly increases the half-life of the siRNA. The Hfq adapting scaffold present in the Expression vectors pGuide_Hfq and pGuide_OmpA_Hfq is recommendable in most cases, as it protects the siRNA and strengthens the bond to the target sequence. The vector used determines which overlaps to the vector need to be included into the siRNAs. The overlaps for the different vectors can be seen in Table 3.</li> |
− | <li>Design the siRNAs. Either by using our tool to predict siRNAs | + | <li>Design the siRNAs. Either by using our <a href ="https://2018.igem.org/Team:Bielefeld-CeBiTec/Software">siRCon tool</a> to predict siRNAs, or by adapting externally designed siRNAs to our system.</li> |
<li>Order siRNAs as Oligonucleotides</li> | <li>Order siRNAs as Oligonucleotides</li> | ||
</ul> | </ul> | ||
− | </li> | + | </li><br> |
<li> | <li> | ||
− | + | Transformation and measurement <br> | |
<ul> | <ul> | ||
<li>Perform an oligoannealing and a <a href ="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate assembly </a> as described in our protocols to insert the siRNAs into the expression vector.</li> | <li>Perform an oligoannealing and a <a href ="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate assembly </a> as described in our protocols to insert the siRNAs into the expression vector.</li> | ||
− | <li>Transform the Golden Gate | + | <li>Transform the <a href ="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate Assembly</a> into the competent cells containing the target vector. </li> |
<li>Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.</li> | <li>Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.</li> | ||
Line 363: | Line 388: | ||
<th>Vektor</th> | <th>Vektor</th> | ||
<th>Linker</th> | <th>Linker</th> | ||
− | <th>Forward Primer </th> | + | <th>Forward Primer</th> |
− | <th>Reverse Primer </th> | + | <th>Reverse Primer</th> |
<th>Tm</th> | <th>Tm</th> | ||
</tr> | </tr> | ||
Line 375: | Line 400: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_BFP</ | + | <th>pTale1_BFP</th> |
<td>all</td> | <td>all</td> | ||
<td>gtgatagagattgacatccctatcagtg</td> | <td>gtgatagagattgacatccctatcagtg</td> | ||
Line 382: | Line 407: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_AmilCP</ | + | <th>pTale1_AmilCP</th> |
<td>all</td> | <td>all</td> | ||
<td>gtgatagagattgacatccctatcagtg</td> | <td>gtgatagagattgacatccctatcagtg</td> | ||
Line 389: | Line 414: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale2</ | + | <th>pTale2</th> |
<td>all</td> | <td>all</td> | ||
<td>gtgatagagattgacatccctatcagtg</td> | <td>gtgatagagattgacatccctatcagtg</td> | ||
Line 396: | Line 421: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale2_amplification</ | + | <th>pTale2_amplification</th> |
<td>GGGGS</td> | <td>GGGGS</td> | ||
− | <td> | + | <td>gggggtggaggttcgg</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale2_amplification</ | + | <th>pTale2_amplification</th> |
<td>EAAAK</td> | <td>EAAAK</td> | ||
− | <td> | + | <td>gaggcggctgcaaaagag</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale2_amplification</ | + | <th>pTale2_amplification</th> |
<td>cMyc</td> | <td>cMyc</td> | ||
− | <td> | + | <td>gaacagaagctgattagcgaagaag</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale2_amplification</ | + | <th>pTale2_amplification</th> |
<td>XP</td> | <td>XP</td> | ||
− | <td> | + | <td>gctcccgctccgaagc</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_ amplification</ | + | <th>pTale1_ amplification</th> |
<td>GGGGS</td> | <td>GGGGS</td> | ||
− | <td> | + | <td>gggggtggaggttcgg</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_ amplification</ | + | <th>pTale1_ amplification</th> |
<td>EAAAK</td> | <td>EAAAK</td> | ||
− | <td> | + | <td>gaggcggctgcaaaagag</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_ amplification</ | + | <th>pTale1_ amplification</th> |
<td>xMyc</td> | <td>xMyc</td> | ||
− | <td> | + | <td>gaacagaagctgattagcgaagaag</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <th>pTale1_ amplification</ | + | <th>pTale1_ amplification</th> |
<td>XP</td> | <td>XP</td> | ||
− | <td> | + | <td>gctcccgctccgaagc</td> |
− | <td> | + | <td>catctttcctgtgtgagtgctcag</td> |
<td>57°C</td> | <td>57°C</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
+ | |||
<table id="t01" class="centern"> | <table id="t01" class="centern"> | ||
Line 495: | Line 521: | ||
<div id="myDIV" class="reftext"> | <div id="myDIV" class="reftext"> | ||
+ | <b>Chen, S., Zhang, A., Blyn, L. B., & Storz, G. (2004).</b> MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. <i>Journal of bacteriology, 186</i>(20), 6689-6697. | ||
Latest revision as of 22:32, 1 December 2018
Silencing Results
Short summary
The Tace system
We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA.
It is important to make all expressed siRNAs comparable to each other. Therefore we designed four BioBricks featuring the same promoter to establish the same expression rate for all siRNAs. As a first generation, we designed the four BioBricks BBa_K2638701, BBa_K2638702, BBa_K2638758 and BBa_K2638759 (Figure 1-4) for our expression vectors. They contain a Golden Gate Assembly (GGA) cassette which can be cut out using the restriction enzyme BbsI. So it is possible to replace the whole GGA cassette with a specific siRNA with the usage of our GGA protocol. The transcription of the siRNA is terminated by the strong Terminator BBa_B0015 to make sure that all expression processes are completely terminated.
While the BioBrick BBa_K2638701(Figure 1) is supposed to transcribe an siRNA without further modifications, the BioBrick BBa_K2638702 (Figure 2) also includes the Hfq binding sequence originating of the MicC-siRNA (Chen et al., 2004). The BioBrick BBa_K2638758 (Figure 3) contains the 5’-UTR from ompA as a protective sequence upstream of the siRNA insertion site and the BioBrick BBa_K2638759 (Figure 4) with both features surrounding the insertion site as well as sequences combined to add further functions to the siRNA.
Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The second part of our TACE system is a target vector, pTale, which transcribes one specific mRNA. The chosen mRNA should be silenced by the constructed siRNAs using one of the described BioBricks above. To get the optimal conditions for measuring the silencing effect of our siRNA we scheduled and constructed two generations of target vectors. For the first generation of the target vectors we used two different Reporter Proteins: the chromoprotein AmilCp (BBa_K592009) and the blue fluorescent protein BFP (BBa_K592100). Additionaly feature the target BioBrick a linker between the GGA cassette and the reporter protein. This way, the inserted target mRNA forms a CDS fusion with the reporter protein without losing any function. If the mRNA is destroyed, no reporter protein is formed. This results in no measurement of the BFP fluorescents which is proportional to the silencing strength of the siRNA. The Target Vectors were cloned with 4 different linkers (GGGGS, BBa_K2638721; EAAAK, BBa_K2638722<(a>; XP, BBa_K2638723; cMyc, BBa_K2638724), so users of this System can choose the perfect linker for their own system. The structure of the first generation of pTale is shown in Figure 5.
BioBrick number | Tag | Linker | Reporter Protein | Other features |
---|---|---|---|---|
BBa_K2638711 | pTale_A_GS | GGGGS | AmilCP | - |
BBa_K2638712 | pTale_A_EA | EAAAK | AmilCP | - |
BBa_K2638713 | pTale_A_CM | cMyc | AmilCP | - |
BBa_K2638714 | pTale_A_XP | XP | AmilCP | - |
BBa_K2638707 | pTale_B_GS | GGGGS | BFP | - |
BBa_K2638708 | pTale_B_EA | EAAAK | BFP | - |
BBa_K2638709 | pTale_B_CM | cMyc | BFP | - |
BBa_K2638710 | pTale_B_XP | XP | BFP | - |
BBa_K2638707 | pTale2_B_GS | GGGGS | BFP | 2. Generation |
BBa_K2638708 | pTale2_B_EA | EAAAK | BFP | 2. Generation |
BBa_K2638709 | pTale2_B_CM | cMyc | BFP | 2. Generation |
BBa_K2638710 | pTale2_B_XP | XP | BFP | 2. Generation |
BBa_K2638701 | pGuide | - | - | - |
BBa_K2638702 | pGuide_Hfq | - | - | Hfq scaffold |
BBa_K2638758 | pGuide_Omp | - | - | OmpA 5’-UTR |
BBa_K2638759 | pGuide_Hfq_Omp | - | - | Hfq Scaffold, Hfq Scaffold |
Testing the System
The results presented in figures 7 and 8 show that the cells were growing very slowly in the 12 h of measurement time owing to the oxygen limited culture conditions in the 96 well plate used. In Figure 7 a significant increase in the Fluorescence of BFP was visible, but no noteworthy increase in the Fluorescence signal of GFP was detectable. Sequencing showed that only 50 BP of the GFP were inserted into the Target vector, explaining the missing fluorescence signal. Though it could not be shown that our system works with larger protein fusions, we were able to show that our vector works as expected with short target sequences. Vice versa, in Figure 8 a strong GFP signal was detectable, while no BFP was produced. Possibly the larger GFP protein keeps the BFP from folding correctly or inhibits the fluorophore formation in another way. Both figures show a strong increase in Fluorescence upon induction with ahTc. This confirms that the strain is producing the TetR repressor, but not on a level that is high enough to repress the promotor. Possibly the copy number of pSb1C3 proved to be too high, so that not enough TetR was abundant.
Next, we tried to clone the Guide vectors into competent cells containing the target vectors shown above. As the cells were constantly expressing GFP, we were not able to perform the blue white screening following the Golden Gate Assembly, and therefore were not able to test the pTale vectors in combination with the pGuide vectors. We were however able to clone the pGuide BioBricks into a pSB1K3 plasmid which had its native origin of replication (ori) replaced with a synthetic one (BBa_K2638751) made from parts of Team Vilnius 2017. We were able to grow cells containing that vector and sequence the ori.
As we ran out of time, we were not able to perform further tests on these vectors.
Next, we tried to clone the Guide vectors into competent cells containing the target vectors shown above. As the cells were constantly expressing GFP, we were not able to perform the blue white screening following the Golden Gate Assembly, and therefore were not able to test the pTale vectors in combination with the pGuide vectors. We were however able to clone the pGuide BioBricks into a pSB1K3 plasmid which had its native origin of replication (ori) replaced with a synthetic one (BBa_K2638751) made from parts of Team Vilnius 2017. We were able to grow cells containing that vector and sequence the ori.
As we ran out of time, we were not able to perform further tests on these vectors.
Usage protocol
-
Prepare BioBricks
To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore, the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of iGEM Vilnius 2017 are extremely useful for this purpose. -
Preparation of the target sequences
Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence.-
There are two ways to clone a target sequence into a target vector:
- By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.
- By Golden Gate assembly: Specially suitable for short target sequences which can be ordered as oligonucleotides, as overlaps of 4 nucleotides are needed to assemble the vector. Dimerize the oligos by Oligo Annealing and perform the Golden Gate assembly as described in our protocols. This might be useful when only a fragment of a coding sequence is used as a target sequence.
- To screen several vectors for the best compartibility with a target sequence transform all vectors with the Target gene inserted.
- For pTale vectors: induce with anhydrotetracycline (ahTc) and compare the levels of formed protein markers.
- For pTale2: Induce with IPTG. Let the cells grow until the BFP can be detected. Induce with ahTc and measure and compare the decline of the BFPs fluorescence to find out if a correctly folded LacI fusion is expressed.
- Once a target vector is chosen, prepare competent cells harboring this vector.
Design siRNAs
- Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the pGuide_Omp vector ( BBa_K2638758), as the OmpA 5-UTR significantly increases the half-life of the siRNA. The Hfq adapting scaffold present in the Expression vectors pGuide_Hfq and pGuide_OmpA_Hfq is recommendable in most cases, as it protects the siRNA and strengthens the bond to the target sequence. The vector used determines which overlaps to the vector need to be included into the siRNAs. The overlaps for the different vectors can be seen in Table 3.
- Design the siRNAs. Either by using our siRCon tool to predict siRNAs, or by adapting externally designed siRNAs to our system.
- Order siRNAs as Oligonucleotides
-
Transformation and measurement
- Perform an oligoannealing and a Golden Gate assembly as described in our protocols to insert the siRNAs into the expression vector.
- Transform the Golden Gate Assembly into the competent cells containing the target vector.
- Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.
Vektor | Linker | Forward Primer | Reverse Primer | Tm |
---|---|---|---|---|
pGuide | - | gattatttgcacggcgtcac | gaggaagcctgcataacgc | 57°C |
pTale1_BFP | all | gtgatagagattgacatccctatcagtg | ccctgagtatggttaatgaacgttttg | 57°C |
pTale1_AmilCP | all | gtgatagagattgacatccctatcagtg | cagtgagctttaccgtctgc | 57°C |
pTale2 | all | gtgatagagattgacatccctatcagtg | gtggcaacgccaatcagc | 57°C |
pTale2_amplification | GGGGS | gggggtggaggttcgg | catctttcctgtgtgagtgctcag | 57°C |
pTale2_amplification | EAAAK | gaggcggctgcaaaagag | catctttcctgtgtgagtgctcag | 57°C |
pTale2_amplification | cMyc | gaacagaagctgattagcgaagaag | catctttcctgtgtgagtgctcag | 57°C |
pTale2_amplification | XP | gctcccgctccgaagc | catctttcctgtgtgagtgctcag | 57°C |
pTale1_ amplification | GGGGS | gggggtggaggttcgg | catctttcctgtgtgagtgctcag | 57°C |
pTale1_ amplification | EAAAK | gaggcggctgcaaaagag | catctttcctgtgtgagtgctcag | 57°C |
pTale1_ amplification | xMyc | gaacagaagctgattagcgaagaag | catctttcctgtgtgagtgctcag | 57°C |
pTale1_ amplification | XP | gctcccgctccgaagc | catctttcctgtgtgagtgctcag | 57°C |
Vektor | Linker | Forward overlap | Reverse overlap |
---|---|---|---|
pTale1, pTale2 | GGGGS | GATG | CCCC |
pTale1, pTale2 | EAAAK | GATG | CCTC |
pTale1, pTale2 | cMyc | GATG | GTTC |
pTale1, pTale2 | XP | GATG | GAGC |
Chen, S., Zhang, A., Blyn, L. B., & Storz, G. (2004). MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. Journal of bacteriology, 186(20), 6689-6697.