Difference between revisions of "Team:Bielefeld-CeBiTec/Composite Part"

 
(20 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
{{:Team:Bielefeld-CeBiTec/Basic_Navbar}}
 
{{:Team:Bielefeld-CeBiTec/Basic_Navbar}}
 +
 
<html>
 
<html>
 +
<head>
 +
<link rel="stylesheet" type="text/css"
 +
href="https://2018.igem.org/Team:Bielefeld-CeBiTec/CSS?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" href="https://cdnjs.cloudflare.com/ajax/libs/font-awesome/4.7.0/css/font-awesome.min.css">
  
  
 +
<script>
  
−
<div class="column full_size judges-will-not-evaluate">
+
window.onscroll = function() {scrollFunction(); checkOffset();};
−
<h3>★ ALERT! </h3>
+
 
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2018.igem.org/Judging/Medals">medal criterion</a> or <a href="https://2018.igem.org/Judging/Awards"> award listed below</a>. </p>
+
function scrollFunction() {
−
<p> Delete this box in order to be evaluated for this medal criterion and/or award. See more information at <a href="https://2018.igem.org/Judging/Pages_for_Awards"> Instructions for Pages for awards</a>.</p>
+
if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
document.getElementById("page-arrow-top").style.display = "block";
 +
} else {
 +
document.getElementById("page-arrow-top").style.display = "none";
 +
}
 +
}
 +
 
 +
function checkOffset() {
 +
    if($('#page-arrow-top').offset().top + $('#page-arrow-top').height()
 +
                                          >= $('#footer').offset().top - 10)
 +
        $('#page-arrow-top').css('position', 'absolute');
 +
    if($(document).scrollTop() + window.innerHeight < $('#footer').offset().top)
 +
        $('#page-arrow-top').css('position', 'fixed'); // restore when you scroll up
 +
}
 +
 
 +
function topFunction() {
 +
document.body.scrollTop = 0; // For Chrome, Safari and Opera
 +
document.documentElement.scrollTop = 0; // For IE and Firefox
 +
}
 +
</script>
 +
 
 +
<style>
 +
.collapse.navbar-collapse {
 +
float:right;
 +
                padding: 0;
 +
                padding-right: 5%;
 +
}
 +
</style>
 +
 +
</head>
 +
 +
 
 +
<body style="height:100%";>
 +
 
 +
<div class="title_picture">
 +
<img style="width:100%" src="https://static.igem.org/mediawiki/2018/c/c4/T--Bielefeld-CeBiTec--colorful_tubes_vk.png">
 +
</div>    
 +
 
 +
      <div class="container">
 +
          <div class="main_content">
 +
 +
               
 +
                <div class="title">Composite Parts</div>
 +
<h2> Short summary</h2>
 +
<article>
 +
We planed and build a lot of composite parts in our projekt. Our best composite part is the pTale_B_GS vector, which ist part of the TACE silencing system. It is part of the second generation of Target vectors, which produce a target mRNA and a reporter Protein to quantify the silencing capabilities of tested siRNAs.
 +
</article>
 +
 
 +
 
 +
  <article>
 +
For our metal resource recovery system we build lots of new basic BioBricks for accumulation and storage of metal ions, toxicity counteractions and nanoparticle formation. In order to find the best expression ratios, we tried different regulator elements, such as promoters, ribosome binding sites and terminators in combination with our genes. Some of our proteins were also fused to other proteins with flexible or rigid linkers connecting them. On this page we list all these composite parts and their components.Not only our promotor testing device, but also our (LINK) TACE siRNA testing system consists mainly of composite parts. An important part are the target vectors, which transcribe a target mRNA and express a reporter Protein to allow the user to measure and quantify the silencing efficiency of siRNAs. So we constructed two generations of target vectors, with a member of the second generation being our best composite part:<br>
 +
 
 +
<b< Best Composite Part – pTale2_B_GS </b><br>
 +
 
 +
This Composite Part Our new TACE system consists of an expression vector which transcribes siRNAs, and a target vector which transcribes a target mRNA as well as a reporter protein which enables the user to quantify the silencing ability of a tested siRNA.<br>
 +
The first generation of target vectors featured a direct fusion of a target sequence to a Reporter Protein (Blue fluorescent Protein BFP or AmilCP). This assures the shortest reaction time possible to the degradation of the target mRNA, as the destruction of the target mRNA also leads to the degradation of the marker proteins mRNA. However this has a problem, as a non-functional reporter protein can lead to false positives. This led to the development of the second generation of vectors. This Generation also features an inverter as well as additional control mechanisms. The vector is shown in Figure 1:<br>
 +
 
 +
  <figure role="group">
 +
                      <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/1/10/T--Bielefeld-CeBiTec--ALE-pTale2_B_GS_V1_for_Best_composite_Part.png">
 +
                      <figcaption>
 +
                          <b> Figure 1:</b> Our best composite part, the target vector <a href="http://parts.igem.org/Part:BBa_K2638703">pTale2_B_GS</a>.
 +
                    </figcaption>
 +
                  </figure>
 +
This innovative system has the potential to replace CRISPR/Cas  in the iGEM contest as it offers as easy and open source way to manipulate the metabolism of an organism.<br>
 +
The part features a Golden Gate Assembly (GGA) Cassette between an ATG and an GGGGS Linker. This allows the user to seamlessly insert a target sequence. Short target sequences can be ordered as oligo nucleotides, annealed and inserted via Golden Gate Assembly. Long Targets can be inserted the same way, if the needed overlaps can be added. Alternatively the Part can be amplified using the Primers in Table 2, and the target sequence can be inserted via Gibson Assembly after adding matching overlaps. Through the start codon upstream of the GGA cassette the LacI inhibitor will still be produced when a target sequence without an own start codon is inserted. However, the user still has to keep the LacI inhibitor in frame with a start codon. The used terminator <a href=”http://parts.igem.org/Part:BBa_B0015”>B0015</a>has  a high terminating ability to prevent random transcription of the reporter protein. Because of the pLac promotor, the time in an experiment when the reporter protein shall be expressed can be chosen freely. BFP was chosen as a reporter protein because it has a low excitation wavelength at 399 nm and emission wavelength at about 450 nm. This  recommends the BFP for a FRET system, making further measurements possible.
 +
 
 +
                  </article>
 +
  <div class="article">
 +
We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA.
 +
It is important to make all expressed siRNAs comparable to each other. Therefore we designed four Biobricks featuring the same promoter to establish the same expression rate for all siRNAs. As a first Generation, we designed the four Biobricks <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>, <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a>, <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a> and <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a> (Figure 1-4) for our expression vectors. They contain a Golden Gate Assembly (GGA) cassette which can be cut out using the restriction enzyme <i>Bbs</i>I. So it is possible to replace the whole GGA cassette with a specific siRNA with the usage of our <a href="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">GGA protocol</a>. The transcription of the siRNA is terminated by the strong Terminator <a href="http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a> to make sure that all expression processes are completely terminated.
 +
While the Biobrick <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>(Figure 1) is supposed to transcribe an siRNA without further modifications, the Biobrick <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a> (Figure 2) also includes the Hfq binding sequence originating of the MicC-siRNA (Chen <i>et al.</i>, 2004).  The Biobrick <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a> (Figure 3) contains the 5’-UTR from ompA as a protective sequence upstream of the siRNA insertion site and the Biobrick <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a> (Figure 4) with both features surrounding the insertion site as well as sequences combined to add further functions to the siRNA.
 +
                  </div>
 +
 
 +
                    <figure role="group">
 +
                      <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/3/3e/T--Bielefeld-CeBiTec--ALE-pGuide_V2_Genkarte.png">
 +
                      <figcaption>
 +
                          <b>Figure 1:</b> Illustration of Biobrick <a href="http://parts.igem.org/Part:BBa_K2638701">BBa_K2638701</a>, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the <i>BbsI</i> restriction enzyme to seamlessly fuse an siRNA into the Vector.</b>
 +
                      </figcaption>
 +
                  </figure>
 +
 
 +
  <figure role="group">
 +
                      <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/b/b4/T--Bielefeld-CeBiTec--ALE-pGuide-Hfq_V2.png">
 +
                      <figcaption>
 +
                          <b>Figure 2:</b> Illustration of Biobrick <a href="http://parts.igem.org/Part:BBa_K2638702">BBa_K2638702</a>, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA to the Hfq binding Sequence inside the expression Vector.
 +
                      </figcaption>
 +
                  </figure>
 +
 
 +
 
 +
 
 +
  <figure role="group">
 +
                      <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/7/77/T--Bielefeld-CeBiTec--ALE-pGuide_OmpA_V2.png">
 +
                      <figcaption>
 +
                          <b>Figure 3:</b> Illustration of Biobrick <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a>, an expression Vector for siRNAs. The Biobrick includes a golden Gate Cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (5’ UTR) upstream of the site of insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation.
 +
                      </figcaption>
 +
                  </figure>
 +
 
 +
  <figure role="group">
 +
                      <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/7/7d/T--Bielefeld-CeBiTec--ALE-pGuide_OmpA_Hfq_V2.png">
 +
                      <figcaption>
 +
                          <b>Figure 4:</b> Illustration of Biobrick <a href="http://parts.igem.org/Part:BBa_K2638759">BBa_K2638759</a>, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (UTR)upstream, and the Hfq binding Sequence downstream of the site of siRNA insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation.
 +
                      </figcaption>
 +
                  </figure>
 +
 
 +
<div class="article">
 +
Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The second part of our TACE  system is a target vector, pTale, which transcribes one specific mRNA. The chosen mRNA should be silenced by the constructed siRNAs using one of the described Biobricks above. To get the optimal conditions for measuring the silencing effect of our siRNA we scheduled and constructed two Generations of target vectors. For the first generation of the target vectors we used two different Reporter Proteins: the chromoprotein <a href="http://parts.igem.org/Part:BBa_K292009">AmilCp</a> (BBa_K592009) and the blue fluorescent protein <a href="http://parts.igem.org/Part:BBa_K592100">BFP</a> (BBa_K592100). Additionaly feature the target Biobrick a linker between the GGA cassette and the reporter protein. This way, the inserted target mRNA forms a CDS fusion with the reporter protein without losing any function. If the mRNA is destroyed, no reporter protein is formed. This results in no measurement of the BFP fluorescents which is proportional to the silencing strength of the siRNA. The Target Vectors were cloned with 4 different linkers (<a href="http://parts.igem.org/Part:BBa_K2638721">GGGGS, BBa_K2638721</a>; <a href="http://parts.igem.org/Part:BBa_K2638722">EAAAK, BBa_K2638722<(a>; <a href="http://parts.igem.org/Part:BBa_K2638723">XP, BBa_K2638723</a>; <a href="http://parts.igem.org/Part:BBa_K2638724">cMyc, BBa_K2638724</a>), so users of this System can choose the perfect linker for their own system. The structure of the first generation of pTale is shown in Figure 5.
 
</div>
 
</div>
 +
 +
 +
<figure role="group">
 +
  <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/0a/T--Bielefeld-CeBiTec--ALE-pTale_V1.png">
 +
  <figcaption>
 +
      <b>Figure 5:</b> Structure of the first generationof the target vector pTale. Four different Linkers were cloned. BFP and AmilCP were tested as Reporter Proteins. The Golden Gate Cassette, the Linker and the reporter protein form a fused unit and do not contain Biobrick scars.
 +
  </figcaption>
 +
</figure>
 +
 +
<article>
 +
While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. This construct prevents false positive results generated by non-functional reporter proteins, as the fluorescence increases with higher silencing activity instead of decreasing with higher silencing effectivity.
 +
</article>
 +
 +
 +
<figure role="group">
 +
  <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/7/73/T--Bielefeld-CeBiTec--ALE-pTale2_V1.png">
 +
  <figcaption>
 +
      <b>Figure 6:</b> Structure of the second generation of the target vector pTale. The Golden Gate Cassette, the Linker and the LacI inhibitor are fused and do not feature scars between parts.
 +
  </figcaption>
 +
</figure>
 +
 +
<article>
 +
 +
</article>
 +
 +
 +
<article>
 +
All Vectors with corresponding linkers and reporter proteins can be found in Table 1:
 +
</article>
 +
 +
<table id="t01" class="centern">
 +
<caption class="table_caption"> <b>Table 1: </b>List of Expression vectors (pGuide) and target vectors (pTale) that were constructed in this project and their corresponding linkers, reporter proteins and other features.</caption>
 +
  <tr>
 +
<th>Biobrick number </th>
 +
<th>Tag </th>
 +
<th>Linker </th>
 +
<th>Reporter Protein </th>
 +
<th>Other features</th>
 +
                  </tr>
 +
 +
                  <tr>
 +
<th>BBa_K2638711</th>
 +
<td> pTale_A_GS</td>
 +
<td>GGGGS </td>
 +
<td>AmilCP </td>
 +
<td> -</td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638712</th>
 +
<td> pTale_A_EA</td>
 +
<td>EAAAK </td>
 +
<td> AmilCP</td>
 +
<td>- </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638713</th>
 +
<td>pTale_A_CM </td>
 +
<td> cMyc</td>
 +
<td>AmilCP </td>
 +
<td>- </td>
 +
                  </tr>
 +
                  <tr>
 +
<th> BBa_K2638714</th>
 +
<td>pTale_A_XP</td>
 +
<td> XP</td>
 +
<td>AmilCP </td>
 +
<td>- </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638707</th>
 +
<td>pTale_B_GS</td>
 +
<td> GGGGS</td>
 +
<td> BFP</td>
 +
<td> -</td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638708</th>
 +
<td> pTale_B_EA</td>
 +
<td> EAAAK</td>
 +
<td>BFP </td>
 +
<td>- </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638709</th>
 +
<td>pTale_B_CM </td>
 +
<td> cMyc</td>
 +
<td> BFP</td>
 +
<td>- </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638710</th>
 +
<td>pTale_B_XP</td>
 +
<td>XP</td>
 +
<td>BFP </td>
 +
<td> -</td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638707</th>
 +
<td>pTale2_B_GS</td>
 +
<td> GGGGS</td>
 +
<td> BFP</td>
 +
<td>2. Generation </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638708</th>
 +
<td> pTale2_B_EA</td>
 +
<td> EAAAK</td>
 +
<td>BFP </td>
 +
<td> 2. Generation</td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638709</th>
 +
<td>pTale2_B_CM </td>
 +
<td> cMyc</td>
 +
<td> BFP</td>
 +
<td>2. Generation </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638710</th>
 +
<td>pTale2_B_XP</td>
 +
<td>XP</td>
 +
<td>BFP </td>
 +
<td>2. Generation </td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638701 </th>
 +
<td>pGuide </td>
 +
<td>-</td>
 +
<td>-</td>
 +
<td>-</td>
 +
                  </tr>
 +
                  <tr>
 +
<th> BBa_K2638702</th>
 +
<td>pGuide_Hfq </td>
 +
<td>-</td>
 +
<td>-</td>
 +
<td>Hfq scaffold</td>
 +
                  </tr>
 +
                  <tr>
 +
<th>BBa_K2638758 </th>
 +
<td> pGuide_Omp</td>
 +
<td>-</td>
 +
<td>-</td>
 +
<td>OmpA 5’-UTR</td>
 +
                  </tr>
 +
                  <tr>
 +
<th> BBa_K2638759</th>
 +
<td> pGuide_Hfq_Omp</td>
 +
<td>-</td>
 +
<td>-</td>
 +
<td>Hfq Scaffold, Hfq Scaffold</td>
 +
                  </tr>
 +
</table>
 +
 +
<a name="testing" id="testing" class="shifted-anchor"></a>
 +
<h2> Testing the System </h2>
 +
<article>
 +
 +
As we had great difficulties to assemble the vectors, we had very little time left to test the system. Amongst other small hinderances, major faults in IDT gene syntheses were the cause of great time losses. In the end we were able to assemble and transform all vectors belonging to the system.
 +
We were able to test the Target vectors cloning GFP as a target sequence into all target vectors. The OD600 and the fluorescence of BFG and GFP were measured in 96 well plates as described in the usage Protocol below using a Teacon reader. 3 replicates were measured for each sample. The results of the measurement of pTale1_B_CM are in figures 7 and 8 shown below. Two clones were tested, one of them showing expression of BFP, and one showing expression of GFP. No clones expressing both proteins were detected
 +
 +
</article>
 +
 +
 +
<figure role="group">
 +
                      <img class="figure eighty" src="https://static.igem.org/mediawiki/2018/d/d4/T--Bielefeld-CeBiTec--ALE-Vectortest_T1B_BFP.png">
 +
                      <figcaption>
 +
                          <b> Figure 7:</b> Meassurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that only 50 BP of GFB were inserted as target sequence.
 +
                      </figcaption>
 +
                  </figure>
 +
<figure role="group">
 +
                      <img class="figure eighty" src="https://static.igem.org/mediawiki/2018/5/5d/T--Bielefeld-CeBiTec--ALE-Vectortest_T1B_GFP_V1.png">
 +
                      <figcaption>
 +
                        <b> Figure 8:</b> Measurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that a complete GFB was inserted as target sequence.
 +
                      </figcaption>
 +
                  </figure>
 +
 +
<div class="article">
 +
The results presented in figures 7 and 8 show that the cells were growing very slowly in the 12 h of measurement time owing to the oxygen limited culture conditions in the 96 well plate used. In Figure 7 a significant increase in the Fluorescence of BFP was visible, but no noteworthy increase in the Fluorescence signal of GFP was detectable. Sequencing showed that only 50 BP of the GFP were inserted into the Target vector, explaining the missing fluorescence signal. Though it could not be shown that our system works with larger protein fusions, we were able to show that our vector works as expected with short target sequences. Vice versa, in Figure 8 a strong GFP signal was detectable, while no BFP was produced. Possibly the larger GFP protein keeps the BFP from folding correctly or inhibits the fluorophore formation in another way. Both figures show a strong increase in Fluorescence upon induction with ahTc. This confirms that the strain is producing the TetR repressor, but not on a level that is high enough to repress the promotor. Possibly the copy number of pSb1C3 proved to be too high, so that not enough TetR was abundant. <br>
 +
Next, we tried to clone the Guide vectors into competent cells containing the target vectors shown above. As the cells were constantly expressing GFP, we were not able to perform the blue white screening following the Golden Gate Assembly, and therefore were not able to test the pTale vectors in combination with the pGuide vectors. We were however able to clone the pGuide Biobricks into a pSB1K3 plasmid which had its native origin of replication (ori) replaced with a synthetic one (<a href="http://parts.igem.org/Part:BBa_K2638751">BBa_K2638751</a>)  made from parts of Team Vilnius 2017. We were able to grow cells containing that vector and sequence the ori. <br>
 +
As we ran out of time, we were not able to perform further tests on these vectors.
 +
</div>
 +
 +
 +
 +
<a name="usage" id="usage" class="shifted-anchor"></a>
 +
<h2> Usage protocol </h2>
 +
 +
<figure role="group">
 +
  <img class="figure hundred" src="https://static.igem.org/mediawiki/2018/0/01/T--Bielefeld-CeBiTec--ALE-siRNA_Testsystem_Übersichtsgrafik_2.png">
 +
  <figcaption>
 +
      <b>Figure 9:</b> Schematic overview that shows how to use our siRNA Testing System.</b>
 +
  </figcaption>
 +
</figure>
 +
 +
<article>
 +
 +
All experiments should be conducted in an E. coli strain producing the TetR repressor. Alternatively, a construct producing TetR can be cloned into the pTale vectors.<br>
 +
<ol type="1">
 +
<li>
 +
Prepare Biobricks<br>
 +
To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore,  the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of <a href="https://2017.igem.org/Team:Vilnius-Lithuania">iGEM Vilnius 2017</a> are extremely useful for this purpose.
 +
</li>
 +
<li> <br>
 +
Preparation of the target sequences <br>
 +
 +
Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence.
 +
<ul>
 +
There are two ways to clone a target sequence into a target vector:
 +
<li>By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.</li>
 +
<li>By Golden Gate assembly: Specially suitable for short target sequences which can be ordered as oligonucleotides, as overlaps of 4 nucleotides are needed to assemble the vector. Dimerize the oligos by<a href="https://static.igem.org/mediawiki/2018/f/f7/T--Bielefeld-CeBiTec--ssDNA_Annealing_LK.pdf"> Oligo Annealing</a> and perform the <a href="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate assembly</a> as described in our protocols. This might be useful when only a fragment of a coding sequence is used as a target sequence.</li>
 +
</ul>
 +
 +
<ul>
 +
<li>To screen several vectors for the best compartibility with a target sequence transform all vectors with the Target gene inserted.</li>
 +
<li>For pTale vectors: induce with anhydrotetracycline (ahTc) and compare the levels of formed protein markers.</li>
 +
<li>For pTale2: Induce with IPTG. Let the cells grow until the BFP can be detected. Induce with ahTc and measure and compare the decline of the BFPs fluorescence to find out if a correctly folded LacI fusion is expressed.</li>
 +
<li>Once a target vector is chosen, prepare competent cells harboring this vector.</li>
 +
</ul>
 +
 +
</li>
 +
 +
</li>
 +
<li><br>
 +
Design siRNAs <br>
 +
<ul>
 +
<li>Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the <a href="http://parts.igem.org/Part:BBa_K2638758">pGuide_Omp vector</a> ( <a href="http://parts.igem.org/Part:BBa_K2638758">BBa_K2638758</a>), as the OmpA 5-UTR significantly increases the half-life of the siRNA. The Hfq adapting scaffold present in the Expression vectors pGuide_Hfq and pGuide_OmpA_Hfq is recommendable in most cases, as it protects the siRNA and strengthens the bond to the target sequence. The vector used determines which overlaps to the vector need to be included into the siRNAs. The overlaps for the different vectors can be seen in Table 3.</li>
 +
<li>Design the siRNAs. Either by using our <a href ="https://2018.igem.org/Team:Bielefeld-CeBiTec/Software">siRCon tool</a> to predict siRNAs, or by adapting externally designed siRNAs to our system.</li>
 +
<li>Order siRNAs as Oligonucleotides</li>
 +
</ul>
 +
</li><br>
 +
<li>
 +
Transformation and measurement <br>
 +
<ul>
 +
<li>Perform an oligoannealing and a <a href ="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate assembly </a> as described in our protocols to insert the siRNAs into the expression vector.</li>
 +
<li>Transform the <a href ="https://static.igem.org/mediawiki/2018/6/69/T--Bielefeld-CeBiTec--Plasmid_Assembly_Protocol_with_Golden_Gate_Assembly_LK.pdf">Golden Gate Assembly</a> into the competent cells containing the target vector. </li>
 +
 +
<li>Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.</li>
 +
</ul>
 +
</li>
 +
</ol>
 +
</article>
 +
 +
<table id="t01" class="centern">
 +
<caption class="table_caption"> <b>Table 2: </b>Primers for sequencing, colony PCR and amplification of the Tace vectors.</caption>
 +
  <tr>
 +
<th>Vektor</th>
 +
<th>Linker</th>
 +
<th>Forward Primer </th>
 +
<th>Reverse Primer </th>
 +
<th>Tm</th>
 +
                  </tr>
 +
  <tr>
 +
<th>pGuide</td>
 +
<td>-</td>
 +
<td>gattatttgcacggcgtcac</td>
 +
<td>gaggaagcctgcataacgc</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_BFP</td>
 +
<td>all</td>
 +
<td>gtgatagagattgacatccctatcagtg</td>
 +
<td>ccctgagtatggttaatgaacgttttg</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_AmilCP</td>
 +
<td>all</td>
 +
<td>gtgatagagattgacatccctatcagtg</td>
 +
<td>cagtgagctttaccgtctgc</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale2</td>
 +
<td>all</td>
 +
<td>gtgatagagattgacatccctatcagtg</td>
 +
<td>gtggcaacgccaatcagc</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale2_amplification</td>
 +
<td>GGGGS</td>
 +
<td>gggggtggaggttcgg</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale2_amplification</td>
 +
<td>EAAAK</td>
 +
<td>gaggcggctgcaaaagag</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale2_amplification</td>
 +
<td>cMyc</td>
 +
<td>gaacagaagctgattagcgaagaag</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale2_amplification</td>
 +
<td>XP</td>
 +
<td>gctcccgctccgaagc</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_ amplification</td>
 +
<td>GGGGS</td>
 +
<td>gggggtggaggttcgg</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_ amplification</td>
 +
<td>EAAAK</td>
 +
<td>gaggcggctgcaaaagag</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_ amplification</td>
 +
<td>xMyc</td>
 +
<td>gaacagaagctgattagcgaagaag</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1_ amplification</td>
 +
<td>XP</td>
 +
<td>gctcccgctccgaagc</td>
 +
<td>catctttcctgtgtgagtgctcag</td>
 +
<td>57°C</td>
 +
                  </tr>
 +
</table>
 +
 +
<table id="t01" class="centern">
 +
<caption class="table_caption"> <b>Table 3: </b>Table 3: The overlaps needed to insert DNA into several vectors.</caption>
 +
  <tr>
 +
<th>Vektor</th>
 +
<th>Linker</th>
 +
<th>Forward overlap </th>
 +
<th>Reverse overlap </th>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1, pTale2</th>
 +
<td>GGGGS</td>
 +
<td>GATG</td>
 +
<td>CCCC</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1, pTale2</th>
 +
<td>EAAAK</td>
 +
<td>GATG</td>
 +
<td>CCTC</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1, pTale2</th>
 +
<td>cMyc</td>
 +
<td>GATG</td>
 +
<td>GTTC</td>
 +
                  </tr>
 +
  <tr>
 +
<th>pTale1, pTale2</th>
 +
<td>XP</td>
 +
<td>GATG</td>
 +
<td>GAGC</td>
 +
                  </tr>
 +
 +
</table>
 +
 +
 +
 +
<h2>All Composite Parts</h2>
 +
 +
               
 +
 +
<table id="t01" class="centern">
 +
<caption><b>Table 4:</b> All composite Parts submitted by iGEM Bielefeld 2018.</caption>
 +
        <tr>
 +
            <th>Identifier</th>
 +
            <th>Components</th>
 +
            <th>Description</th>
 +
            <th>Designer</th>
 +
            <th>Length</th>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638003</th>
 +
            <td>BBa_K525998, BBa_K2638001</td>
 +
            <td>T7 + RBS + CopC</td>
 +
            <td>Erika Schneider</td>
 +
            <td>425</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638004</th>
 +
            <td>BBa_K525998, BBa_K2638002</td>
 +
            <td>T7 + RBS + CopD</td>
 +
            <td>Erika Schneider</td>
 +
            <td>950</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638005</th>
 +
            <td>BBa_I0500, BBa_B0030, BBa_K2638001</td>
 +
            <td>T7 + RBS + CopC</td>
 +
            <td>Erika Schneider</td>
 +
            <td>1626</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638006</th>
 +
            <td>BBa_I0500, BBa_B0030, BBa_K2638002</td>
 +
            <td>T7 + RBS + CopD</td>
 +
            <td>Erika Schneider</td>
 +
            <td>2151</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638109</th>
 +
            <td>BBa_R0040, BBa_K1460002</td>
 +
            <td>PTetR + CRS5</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>1032</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638110</th>
 +
            <td>BBa_J61101, BBa_K2638103, BBa_J61101, BBa_K2638150</td>
 +
            <td>PTetR + gshA + gshB + Phyto</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>2450</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638112</th>
 +
            <td>BBa_I0500, BBa_B0030 BBa_B0034, BBa_K2638121, BBa_B0034, BBa_K2638103, BBa_B0034, BBa_K2638120</td>
 +
            <td>PTetR + gshA + gshB + GSR</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>4167</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638113</th>
 +
            <td>BBa_I0500, BBa_B0030, BBa_B0034, BBa_K2638100</td>
 +
            <td>PTetR + ahpC + ahpF</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>1800</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638114</th>
 +
            <td>BBa_R0040, BBa_K554003, BBa_K1104200</td>
 +
            <td>PTetR + SoxR + RBS + OxyR</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>1489</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638117</th>
 +
            <td>BBa_R0040, BBa_J61101, BBa_K2638106</td>
 +
            <td>PTetR + RBS + sodA + KatE</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>701</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638118</th>
 +
            <td>BBa_R0040, BBa_B0034, BBa_K2638406, BBa_B0034, BBa_K2638105</td>
 +
            <td>PTetR + RBS + sodA + KatG</td>
 +
            <td>Johannes Ruhnau</td>
 +
            <td>2908</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638201</th>
 +
            <td>BBa_K525998, BBa_K2638200</td>
 +
            <td>OprC (TonB dependent copper transport porin, BBa_K2638200) with T7 promotor and RBS (BBa_K525998)</td>
 +
            <td>Jakob Zubek</td>
 +
            <td>2165</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638204</th>
 +
            <td>BBa_I0500, BBa_B0030, BBa_K2638200</td>
 +
            <td>OprC (TonB dependent copper transport porin, BBa_K2638200) with AraC/pBad</td>
 +
            <td>Jakob Zubek</td>
 +
            <td>3366</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638400</th>
 +
            <td>BBa_K2638500</td>
 +
            <td>Combination of BBa_K2638500 + BBa_K2638560</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638401</th>
 +
            <td>BBa_K2638502, BBa_K2638426</td>
 +
            <td>13</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638402</th>
 +
            <td>BBa_K2638503, BBa_K2638426</td>
 +
            <td>14</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638403</th>
 +
            <td>BBa_K2638504, BBa_K2638426</td>
 +
            <td>15</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638404</th>
 +
            <td>BBa_K2638506, BBa_K2638426</td>
 +
            <td>17</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638405</th>
 +
            <td>BBa_K2638507, BBa_K2638426</td>
 +
            <td>18</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638406</th>
 +
            <td>BBa_K2638509, BBa_K2638426</td>
 +
            <td>110</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638407</th>
 +
            <td>BBa_K2638510, BBa_K2638426</td>
 +
            <td>111</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638408</th>
 +
            <td>BBa_K2638511, BBa_K2638426</td>
 +
            <td>112</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638409</th>
 +
            <td>BBa_K2638517, BBa_K2638426</td>
 +
            <td>118</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>903</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638410</th>
 +
            <td>BBa_K2638520, BBa_K2638426</td>
 +
            <td>21</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638411</th>
 +
            <td>BBa_K26358522, BBa_K2638426</td>
 +
            <td>23</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638412</th>
 +
            <td>BBa_K2638525, BBa_K2638426</td>
 +
            <td>26</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638413</th>
 +
            <td>BBa_K2638526, BBa_K2638426</td>
 +
            <td>27</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638414</th>
 +
            <td>BBa_K2638528, BBa_K2638426</td>
 +
            <td>29</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638415</th>
 +
            <td>BBa_K2638531, BBa_K2638426</td>
 +
            <td>212</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>890</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638416</th>
 +
            <td>BBa_K2638532, BBa_K2638426</td>
 +
            <td>213</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638417</th>
 +
            <td>BBa_K2638534, BBa_K2638426</td>
 +
            <td>215</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>900</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638418</th>
 +
            <td>BBa_K2638537, BBa_K2638426</td>
 +
            <td>218</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>904</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638419</th>
 +
            <td>BBa_K2638542, BBa_K2638426</td>
 +
            <td>33</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638420</th>
 +
            <td>BBa_K2638545, BBa_K2638426</td>
 +
            <td>36</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638421</th>
 +
            <td>BBa_K2638548, BBa_K2638426</td>
 +
            <td>39</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638422</th>
 +
            <td>BBa_K2638551, BBa2638426</td>
 +
            <td>312</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>889</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638423</th>
 +
            <td>BBa_K2638554, BBa_K2638426</td>
 +
            <td>315</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>899</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638424</th>
 +
            <td>BBa_K26358556, BBa_2638426</td>
 +
            <td>317</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>909</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638425</th>
 +
            <td>BBa_K2638557, BBa_K2638426</td>
 +
            <td>318</td>
 +
            <td>Levin Joe Klages</td>
 +
            <td>903</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638703</th>
 +
            <td>BBa_K2638716, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100</td>
 +
            <td>siRNA Target Vector 2 with BFP and GGGGS Linker</td>
 +
            <td>Antonin Lenzen</td>
 +
            <td>2787</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638704</th>
 +
            <td>BBa_K2638717, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100</td>
 +
            <td>siRNA Target Vector 2 with BFP and GGGGS Linker</td>
 +
            <td>Antonin Lenzen</td>
 +
            <td>2787</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638705</th>
 +
            <td>BBa_K2638718, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100</td>
 +
            <td>siRNA Target Vector 2 with BFP and cMyc Linker</td>
 +
            <td>Antonin Lenzen</td>
 +
            <td>2787</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638706</th>
 +
            <td>BBa_K2638719, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100</td>
 +
            <td>siRNA Target Vector 2 with BFP and XP Linker</td>
 +
            <td>Antonin Lenzen</td>
 +
            <td>2787</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638991</th>
 +
            <td>BBa_I0500, BBa_K2638992</td>
 +
            <td>araBAD and RBS and Mutated Human Ferritin Heavy Chain (without Stop)</td>
 +
            <td>Vanessa Krämer</td>
 +
            <td>1765</td>
 +
        </tr>
 +
        <tr>
 +
            <th>BBa_K2638997</th>
 +
            <td>BBa_K118902, BBa_B0030, BBa_I0500</td>
 +
            <td>araBAD and RBS and Human Ferritin Heavy Chain</td>
 +
            <td>Vanessa Krämer</td>
 +
            <td>1793</td>
 +
        </tr>
 +
       
 +
       
 +
       
 +
       
 +
 +
</table>
 +
                <br><br>
 +
  <hr style="width:60%"></hr>
 +
<button onclick="myFunction()" class="refbtn"> References &#9662;</button>
 +
 +
                  <div id="myDIV" class="reftext">
 +
    <b>Chen, S., Zhang, A., Blyn, L. B., & Storz, G. (2004).</b> MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. <i>Journal of bacteriology, 186</i>(20), 6689-6697.
 +
           
 +
              </div>
 +
    </div>
 +
 +
<!-- Footer -->
 +
<footer id="footer" class="w3-container w3-padding-32 w3-center w3-black w3-xlarge" style="position: absolute; width:100%; z-index:200;">
 +
  <a class="footer-icon" href="https://www.facebook.com/igembielefeld/"> <i class="fa fa-facebook-official" ></i></a>
 +
  <a class="footer-icon" href="https://www.instagram.com/igem.bielefeld/?hl=de"><i class="fa fa-instagram"></i></a>
 +
  <a class="footer-icon" href="https://twitter.com/iGEM_Bielefeld"><i class="fa fa-twitter"></i></a>
 +
</footer>
 +
 +
<img id="page-arrow-top"  src="https://static.igem.org/mediawiki/2018/7/7e/T--Bielefeld-CeBiTec--top_arrow_white_vk.png" style="width:3%" onclick="topFunction()"></img>
 +
 +
 +
 +
      </div>
 +
 +
       
 +
 +
</body>
  
 
</html>
 
</html>

Latest revision as of 04:59, 4 December 2018

Composite Parts

Short summary

We planed and build a lot of composite parts in our projekt. Our best composite part is the pTale_B_GS vector, which ist part of the TACE silencing system. It is part of the second generation of Target vectors, which produce a target mRNA and a reporter Protein to quantify the silencing capabilities of tested siRNAs.
For our metal resource recovery system we build lots of new basic BioBricks for accumulation and storage of metal ions, toxicity counteractions and nanoparticle formation. In order to find the best expression ratios, we tried different regulator elements, such as promoters, ribosome binding sites and terminators in combination with our genes. Some of our proteins were also fused to other proteins with flexible or rigid linkers connecting them. On this page we list all these composite parts and their components.Not only our promotor testing device, but also our (LINK) TACE siRNA testing system consists mainly of composite parts. An important part are the target vectors, which transcribe a target mRNA and express a reporter Protein to allow the user to measure and quantify the silencing efficiency of siRNAs. So we constructed two generations of target vectors, with a member of the second generation being our best composite part:

This Composite Part Our new TACE system consists of an expression vector which transcribes siRNAs, and a target vector which transcribes a target mRNA as well as a reporter protein which enables the user to quantify the silencing ability of a tested siRNA.
The first generation of target vectors featured a direct fusion of a target sequence to a Reporter Protein (Blue fluorescent Protein BFP or AmilCP). This assures the shortest reaction time possible to the degradation of the target mRNA, as the destruction of the target mRNA also leads to the degradation of the marker proteins mRNA. However this has a problem, as a non-functional reporter protein can lead to false positives. This led to the development of the second generation of vectors. This Generation also features an inverter as well as additional control mechanisms. The vector is shown in Figure 1:
Figure 1: Our best composite part, the target vector pTale2_B_GS.
This innovative system has the potential to replace CRISPR/Cas in the iGEM contest as it offers as easy and open source way to manipulate the metabolism of an organism.
The part features a Golden Gate Assembly (GGA) Cassette between an ATG and an GGGGS Linker. This allows the user to seamlessly insert a target sequence. Short target sequences can be ordered as oligo nucleotides, annealed and inserted via Golden Gate Assembly. Long Targets can be inserted the same way, if the needed overlaps can be added. Alternatively the Part can be amplified using the Primers in Table 2, and the target sequence can be inserted via Gibson Assembly after adding matching overlaps. Through the start codon upstream of the GGA cassette the LacI inhibitor will still be produced when a target sequence without an own start codon is inserted. However, the user still has to keep the LacI inhibitor in frame with a start codon. The used terminator B0015has a high terminating ability to prevent random transcription of the reporter protein. Because of the pLac promotor, the time in an experiment when the reporter protein shall be expressed can be chosen freely. BFP was chosen as a reporter protein because it has a low excitation wavelength at 399 nm and emission wavelength at about 450 nm. This recommends the BFP for a FRET system, making further measurements possible.
We designed this system to test as many siRNAs as possible with a high sample throughput. To achieve this, we constructed expression vectors which allow comparable expressions of different siRNAs, as well as a target vector which grants easy measurement of the silencing effectivity of a given siRNA. It is important to make all expressed siRNAs comparable to each other. Therefore we designed four Biobricks featuring the same promoter to establish the same expression rate for all siRNAs. As a first Generation, we designed the four Biobricks BBa_K2638701, BBa_K2638702, BBa_K2638758 and BBa_K2638759 (Figure 1-4) for our expression vectors. They contain a Golden Gate Assembly (GGA) cassette which can be cut out using the restriction enzyme BbsI. So it is possible to replace the whole GGA cassette with a specific siRNA with the usage of our GGA protocol. The transcription of the siRNA is terminated by the strong Terminator BBa_B0015 to make sure that all expression processes are completely terminated. While the Biobrick BBa_K2638701(Figure 1) is supposed to transcribe an siRNA without further modifications, the Biobrick BBa_K2638702 (Figure 2) also includes the Hfq binding sequence originating of the MicC-siRNA (Chen et al., 2004). The Biobrick BBa_K2638758 (Figure 3) contains the 5’-UTR from ompA as a protective sequence upstream of the siRNA insertion site and the Biobrick BBa_K2638759 (Figure 4) with both features surrounding the insertion site as well as sequences combined to add further functions to the siRNA.
Figure 1: Illustration of Biobrick BBa_K2638701, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA into the Vector.
Figure 2: Illustration of Biobrick BBa_K2638702, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme to seamlessly fuse an siRNA to the Hfq binding Sequence inside the expression Vector.
Figure 3: Illustration of Biobrick BBa_K2638758, an expression Vector for siRNAs. The Biobrick includes a golden Gate Cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (5’ UTR) upstream of the site of insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation.
Figure 4: Illustration of Biobrick BBa_K2638759, an expression Vector for siRNAs. The Biobrick includes a Golden Gate cassette which can be cut out using the BbsI restriction enzyme. This seamlessly fuse an siRNA into the expression Vector which contains the ompA 5’- untranslated region (UTR)upstream, and the Hfq binding Sequence downstream of the site of siRNA insertion. The ompA 5’ UTR acts as a protective sequence to protect an siRNA from 5’-dependend degradation.
Therefore, we can choose one of these explained expression vectors to be the first part of the complete TACE-system. The second part of our TACE system is a target vector, pTale, which transcribes one specific mRNA. The chosen mRNA should be silenced by the constructed siRNAs using one of the described Biobricks above. To get the optimal conditions for measuring the silencing effect of our siRNA we scheduled and constructed two Generations of target vectors. For the first generation of the target vectors we used two different Reporter Proteins: the chromoprotein AmilCp (BBa_K592009) and the blue fluorescent protein BFP (BBa_K592100). Additionaly feature the target Biobrick a linker between the GGA cassette and the reporter protein. This way, the inserted target mRNA forms a CDS fusion with the reporter protein without losing any function. If the mRNA is destroyed, no reporter protein is formed. This results in no measurement of the BFP fluorescents which is proportional to the silencing strength of the siRNA. The Target Vectors were cloned with 4 different linkers (GGGGS, BBa_K2638721; EAAAK, BBa_K2638722<(a>; XP, BBa_K2638723; cMyc, BBa_K2638724), so users of this System can choose the perfect linker for their own system. The structure of the first generation of pTale is shown in Figure 5.
Figure 5: Structure of the first generationof the target vector pTale. Four different Linkers were cloned. BFP and AmilCP were tested as Reporter Proteins. The Golden Gate Cassette, the Linker and the reporter protein form a fused unit and do not contain Biobrick scars.
While the measurable Fluorescence is diminished with a higher silencing effectivity when using a first generation pTale, the second generation of the target vector does not feature a direct fusion of the target gene to the reporter gene. The difference to the first generation is that the reporter is cloned behind a pLac promotor while the target sequence is fused to the CDS of the lacI inhibitor. This construct works as an inverter to increase the measurable fluorescence with higher silencing effectivity. Additionally, the plac promotor can be induced and repressed, introducing another layer of control into the system. The vector was constructed with BFP as a reporter protein. The structure of the second generation of pTale can be found in Figure 6. This construct prevents false positive results generated by non-functional reporter proteins, as the fluorescence increases with higher silencing activity instead of decreasing with higher silencing effectivity.
Figure 6: Structure of the second generation of the target vector pTale. The Golden Gate Cassette, the Linker and the LacI inhibitor are fused and do not feature scars between parts.
All Vectors with corresponding linkers and reporter proteins can be found in Table 1:
Table 1: List of Expression vectors (pGuide) and target vectors (pTale) that were constructed in this project and their corresponding linkers, reporter proteins and other features.
Biobrick number Tag Linker Reporter Protein Other features
BBa_K2638711 pTale_A_GS GGGGS AmilCP -
BBa_K2638712 pTale_A_EA EAAAK AmilCP -
BBa_K2638713 pTale_A_CM cMyc AmilCP -
BBa_K2638714 pTale_A_XP XP AmilCP -
BBa_K2638707 pTale_B_GS GGGGS BFP -
BBa_K2638708 pTale_B_EA EAAAK BFP -
BBa_K2638709 pTale_B_CM cMyc BFP -
BBa_K2638710 pTale_B_XP XP BFP -
BBa_K2638707 pTale2_B_GS GGGGS BFP 2. Generation
BBa_K2638708 pTale2_B_EA EAAAK BFP 2. Generation
BBa_K2638709 pTale2_B_CM cMyc BFP 2. Generation
BBa_K2638710 pTale2_B_XP XP BFP 2. Generation
BBa_K2638701 pGuide - - -
BBa_K2638702 pGuide_Hfq - - Hfq scaffold
BBa_K2638758 pGuide_Omp - - OmpA 5’-UTR
BBa_K2638759 pGuide_Hfq_Omp - - Hfq Scaffold, Hfq Scaffold

Testing the System

As we had great difficulties to assemble the vectors, we had very little time left to test the system. Amongst other small hinderances, major faults in IDT gene syntheses were the cause of great time losses. In the end we were able to assemble and transform all vectors belonging to the system. We were able to test the Target vectors cloning GFP as a target sequence into all target vectors. The OD600 and the fluorescence of BFG and GFP were measured in 96 well plates as described in the usage Protocol below using a Teacon reader. 3 replicates were measured for each sample. The results of the measurement of pTale1_B_CM are in figures 7 and 8 shown below. Two clones were tested, one of them showing expression of BFP, and one showing expression of GFP. No clones expressing both proteins were detected
Figure 7: Meassurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that only 50 BP of GFB were inserted as target sequence.
Figure 8: Measurement of the pTale_B_CM vector. To demonstrate its function, GFP was cloned into the vector as a target sequence. Three replicates ware measured for each sample. The measured clone was sequenced, showing that a complete GFB was inserted as target sequence.
The results presented in figures 7 and 8 show that the cells were growing very slowly in the 12 h of measurement time owing to the oxygen limited culture conditions in the 96 well plate used. In Figure 7 a significant increase in the Fluorescence of BFP was visible, but no noteworthy increase in the Fluorescence signal of GFP was detectable. Sequencing showed that only 50 BP of the GFP were inserted into the Target vector, explaining the missing fluorescence signal. Though it could not be shown that our system works with larger protein fusions, we were able to show that our vector works as expected with short target sequences. Vice versa, in Figure 8 a strong GFP signal was detectable, while no BFP was produced. Possibly the larger GFP protein keeps the BFP from folding correctly or inhibits the fluorophore formation in another way. Both figures show a strong increase in Fluorescence upon induction with ahTc. This confirms that the strain is producing the TetR repressor, but not on a level that is high enough to repress the promotor. Possibly the copy number of pSb1C3 proved to be too high, so that not enough TetR was abundant.
Next, we tried to clone the Guide vectors into competent cells containing the target vectors shown above. As the cells were constantly expressing GFP, we were not able to perform the blue white screening following the Golden Gate Assembly, and therefore were not able to test the pTale vectors in combination with the pGuide vectors. We were however able to clone the pGuide Biobricks into a pSB1K3 plasmid which had its native origin of replication (ori) replaced with a synthetic one (BBa_K2638751) made from parts of Team Vilnius 2017. We were able to grow cells containing that vector and sequence the ori.
As we ran out of time, we were not able to perform further tests on these vectors.

Usage protocol

Figure 9: Schematic overview that shows how to use our siRNA Testing System.
All experiments should be conducted in an E. coli strain producing the TetR repressor. Alternatively, a construct producing TetR can be cloned into the pTale vectors.
  1. Prepare Biobricks
    To use this system it is important that a stable integration of two different vectors in the E. coli cell is possible. Therefore, the usage of two selection markers like antibiotic resistances, and optimally the usage of different Origins of Replications with about equal strength is necessary. The parts of iGEM Vilnius 2017 are extremely useful for this purpose.

  2. Preparation of the target sequences
    Prior to the experiments, the target sequences and siRNAs need to be designed. First decide for a target vector to use. It might be useful to try cloning the target sequence into vectors with different linkers and test which works best for a given target sequence.
      There are two ways to clone a target sequence into a target vector:
    • By Gibson Assembly: Linearize the vector using BbsI or amplification with PCR using the primers in Table 2 corresponding to the chosen vector.
    • By Golden Gate assembly: Specially suitable for short target sequences which can be ordered as oligonucleotides, as overlaps of 4 nucleotides are needed to assemble the vector. Dimerize the oligos by Oligo Annealing and perform the Golden Gate assembly as described in our protocols. This might be useful when only a fragment of a coding sequence is used as a target sequence.
    • To screen several vectors for the best compartibility with a target sequence transform all vectors with the Target gene inserted.
    • For pTale vectors: induce with anhydrotetracycline (ahTc) and compare the levels of formed protein markers.
    • For pTale2: Induce with IPTG. Let the cells grow until the BFP can be detected. Induce with ahTc and measure and compare the decline of the BFPs fluorescence to find out if a correctly folded LacI fusion is expressed.
    • Once a target vector is chosen, prepare competent cells harboring this vector.

  3. Design siRNAs
    • Prior to the siRNA design, a mechanism for the silencing should be chosen. Our vector system can be used with any siRNA that has overlaps to the pGuide expression vector. At present, our system also provides three vectors with already integrated sequences to give an siRNA further features. If an siRNA shall be used to prevent the translation of the mRNA, it is advantageous to use the pGuide_Omp vector ( BBa_K2638758), as the OmpA 5-UTR significantly increases the half-life of the siRNA. The Hfq adapting scaffold present in the Expression vectors pGuide_Hfq and pGuide_OmpA_Hfq is recommendable in most cases, as it protects the siRNA and strengthens the bond to the target sequence. The vector used determines which overlaps to the vector need to be included into the siRNAs. The overlaps for the different vectors can be seen in Table 3.
    • Design the siRNAs. Either by using our siRCon tool to predict siRNAs, or by adapting externally designed siRNAs to our system.
    • Order siRNAs as Oligonucleotides

  4. Transformation and measurement
    • Perform an oligoannealing and a Golden Gate assembly as described in our protocols to insert the siRNAs into the expression vector.
    • Transform the Golden Gate Assembly into the competent cells containing the target vector.
    • Measure the reporter protein and the OD600. BFP has an excitation peak at 399 nm and an emission peak at 456 nm. AmilCP has a maximum absorption at 588 nm.
Table 2: Primers for sequencing, colony PCR and amplification of the Tace vectors.
Vektor Linker Forward Primer Reverse Primer Tm
pGuide - gattatttgcacggcgtcac gaggaagcctgcataacgc 57°C
pTale1_BFP all gtgatagagattgacatccctatcagtg ccctgagtatggttaatgaacgttttg 57°C
pTale1_AmilCP all gtgatagagattgacatccctatcagtg cagtgagctttaccgtctgc 57°C
pTale2 all gtgatagagattgacatccctatcagtg gtggcaacgccaatcagc 57°C
pTale2_amplification GGGGS gggggtggaggttcgg catctttcctgtgtgagtgctcag 57°C
pTale2_amplification EAAAK gaggcggctgcaaaagag catctttcctgtgtgagtgctcag 57°C
pTale2_amplification cMyc gaacagaagctgattagcgaagaag catctttcctgtgtgagtgctcag 57°C
pTale2_amplification XP gctcccgctccgaagc catctttcctgtgtgagtgctcag 57°C
pTale1_ amplification GGGGS gggggtggaggttcgg catctttcctgtgtgagtgctcag 57°C
pTale1_ amplification EAAAK gaggcggctgcaaaagag catctttcctgtgtgagtgctcag 57°C
pTale1_ amplification xMyc gaacagaagctgattagcgaagaag catctttcctgtgtgagtgctcag 57°C
pTale1_ amplification XP gctcccgctccgaagc catctttcctgtgtgagtgctcag 57°C
Table 3: Table 3: The overlaps needed to insert DNA into several vectors.
Vektor Linker Forward overlap Reverse overlap
pTale1, pTale2 GGGGS GATG CCCC
pTale1, pTale2 EAAAK GATG CCTC
pTale1, pTale2 cMyc GATG GTTC
pTale1, pTale2 XP GATG GAGC

All Composite Parts

Table 4: All composite Parts submitted by iGEM Bielefeld 2018.
Identifier Components Description Designer Length
BBa_K2638003 BBa_K525998, BBa_K2638001 T7 + RBS + CopC Erika Schneider 425
BBa_K2638004 BBa_K525998, BBa_K2638002 T7 + RBS + CopD Erika Schneider 950
BBa_K2638005 BBa_I0500, BBa_B0030, BBa_K2638001 T7 + RBS + CopC Erika Schneider 1626
BBa_K2638006 BBa_I0500, BBa_B0030, BBa_K2638002 T7 + RBS + CopD Erika Schneider 2151
BBa_K2638109 BBa_R0040, BBa_K1460002 PTetR + CRS5 Johannes Ruhnau 1032
BBa_K2638110 BBa_J61101, BBa_K2638103, BBa_J61101, BBa_K2638150 PTetR + gshA + gshB + Phyto Johannes Ruhnau 2450
BBa_K2638112 BBa_I0500, BBa_B0030 BBa_B0034, BBa_K2638121, BBa_B0034, BBa_K2638103, BBa_B0034, BBa_K2638120 PTetR + gshA + gshB + GSR Johannes Ruhnau 4167
BBa_K2638113 BBa_I0500, BBa_B0030, BBa_B0034, BBa_K2638100 PTetR + ahpC + ahpF Johannes Ruhnau 1800
BBa_K2638114 BBa_R0040, BBa_K554003, BBa_K1104200 PTetR + SoxR + RBS + OxyR Johannes Ruhnau 1489
BBa_K2638117 BBa_R0040, BBa_J61101, BBa_K2638106 PTetR + RBS + sodA + KatE Johannes Ruhnau 701
BBa_K2638118 BBa_R0040, BBa_B0034, BBa_K2638406, BBa_B0034, BBa_K2638105 PTetR + RBS + sodA + KatG Johannes Ruhnau 2908
BBa_K2638201 BBa_K525998, BBa_K2638200 OprC (TonB dependent copper transport porin, BBa_K2638200) with T7 promotor and RBS (BBa_K525998) Jakob Zubek 2165
BBa_K2638204 BBa_I0500, BBa_B0030, BBa_K2638200 OprC (TonB dependent copper transport porin, BBa_K2638200) with AraC/pBad Jakob Zubek 3366
BBa_K2638400 BBa_K2638500 Combination of BBa_K2638500 + BBa_K2638560 Levin Joe Klages 889
BBa_K2638401 BBa_K2638502, BBa_K2638426 13 Levin Joe Klages 889
BBa_K2638402 BBa_K2638503, BBa_K2638426 14 Levin Joe Klages 889
BBa_K2638403 BBa_K2638504, BBa_K2638426 15 Levin Joe Klages 889
BBa_K2638404 BBa_K2638506, BBa_K2638426 17 Levin Joe Klages 889
BBa_K2638405 BBa_K2638507, BBa_K2638426 18 Levin Joe Klages 889
BBa_K2638406 BBa_K2638509, BBa_K2638426 110 Levin Joe Klages 889
BBa_K2638407 BBa_K2638510, BBa_K2638426 111 Levin Joe Klages 889
BBa_K2638408 BBa_K2638511, BBa_K2638426 112 Levin Joe Klages 889
BBa_K2638409 BBa_K2638517, BBa_K2638426 118 Levin Joe Klages 903
BBa_K2638410 BBa_K2638520, BBa_K2638426 21 Levin Joe Klages 890
BBa_K2638411 BBa_K26358522, BBa_K2638426 23 Levin Joe Klages 890
BBa_K2638412 BBa_K2638525, BBa_K2638426 26 Levin Joe Klages 890
BBa_K2638413 BBa_K2638526, BBa_K2638426 27 Levin Joe Klages 890
BBa_K2638414 BBa_K2638528, BBa_K2638426 29 Levin Joe Klages 890
BBa_K2638415 BBa_K2638531, BBa_K2638426 212 Levin Joe Klages 890
BBa_K2638416 BBa_K2638532, BBa_K2638426 213 Levin Joe Klages 889
BBa_K2638417 BBa_K2638534, BBa_K2638426 215 Levin Joe Klages 900
BBa_K2638418 BBa_K2638537, BBa_K2638426 218 Levin Joe Klages 904
BBa_K2638419 BBa_K2638542, BBa_K2638426 33 Levin Joe Klages 889
BBa_K2638420 BBa_K2638545, BBa_K2638426 36 Levin Joe Klages 889
BBa_K2638421 BBa_K2638548, BBa_K2638426 39 Levin Joe Klages 889
BBa_K2638422 BBa_K2638551, BBa2638426 312 Levin Joe Klages 889
BBa_K2638423 BBa_K2638554, BBa_K2638426 315 Levin Joe Klages 899
BBa_K2638424 BBa_K26358556, BBa_2638426 317 Levin Joe Klages 909
BBa_K2638425 BBa_K2638557, BBa_K2638426 318 Levin Joe Klages 903
BBa_K2638703 BBa_K2638716, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100 siRNA Target Vector 2 with BFP and GGGGS Linker Antonin Lenzen 2787
BBa_K2638704 BBa_K2638717, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100 siRNA Target Vector 2 with BFP and GGGGS Linker Antonin Lenzen 2787
BBa_K2638705 BBa_K2638718, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100 siRNA Target Vector 2 with BFP and cMyc Linker Antonin Lenzen 2787
BBa_K2638706 BBa_K2638719, BBa_B0010, BBa_B0012, BBa_R0010, BBa_B0032, BBa_K592100 siRNA Target Vector 2 with BFP and XP Linker Antonin Lenzen 2787
BBa_K2638991 BBa_I0500, BBa_K2638992 araBAD and RBS and Mutated Human Ferritin Heavy Chain (without Stop) Vanessa Krämer 1765
BBa_K2638997 BBa_K118902, BBa_B0030, BBa_I0500 araBAD and RBS and Human Ferritin Heavy Chain Vanessa Krämer 1793


Chen, S., Zhang, A., Blyn, L. B., & Storz, G. (2004). MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. Journal of bacteriology, 186(20), 6689-6697.