Difference between revisions of "Team:Linkoping Sweden/Parts"

Line 35: Line 35:
 
</h3>
 
</h3>
 
<ul>
 
<ul>
 +
<h4>
 +
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4>
 
<li>Composite parts: BBa_K2671420</li>
 
<li>Composite parts: BBa_K2671420</li>
 
<li>Basic Parts: BBa_K2671337</li>
 
<li>Basic Parts: BBa_K2671337</li>
Line 42: Line 44:
 
</ul>
 
</ul>
 
<h4>
 
<h4>
−
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4>
+
Primers used for all our experiments can be found below.</h4>
 
<ul>
 
<ul>
 
<li>Vector reverse (VR): attaccgcctttgagtgagc </li>
 
<li>Vector reverse (VR): attaccgcctttgagtgagc </li>

Revision as of 14:57, 19 September 2018

LiU iGEM

Parts

All parts

Collection

    This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.

  • Composite parts: BBa_K2671420
  • Basic Parts: BBa_K2671337
  • Improved parts:
  • Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026
  • Verified biobrick: BBa_I746909

Primers used for all our experiments can be found below.

  • Vector reverse (VR): attaccgcctttgagtgagc
  • Vector forward 2 (VF2): tgccacctgacgtctaagaa
  • Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
  • Backbone ENX forward (BENXF): tactagtagcggccgctg
  • Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
  • Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
  • Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga