Difference between revisions of "Team:Linkoping Sweden/Parts"
| Line 34: | Line 34: | ||
Collection | Collection | ||
</h3> | </h3> | ||
| − | |||
<h4> | <h4> | ||
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4> | This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4> | ||
| + | <ul> | ||
<li>Composite parts: BBa_K2671420</li> | <li>Composite parts: BBa_K2671420</li> | ||
<li>Basic Parts: BBa_K2671337</li> | <li>Basic Parts: BBa_K2671337</li> | ||
Revision as of 15:43, 19 September 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts:
- Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026
- Verified biobrick: BBa_I746909
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga