Line 14: | Line 14: | ||
<nav> | <nav> | ||
<ul class="liu-menu"> | <ul class="liu-menu"> | ||
− | <li><a | + | <li><a href="/Team:Linkoping_Sweden">Home</a></li> |
− | <li><a class="dropbutton" | + | <li class="dropdown"> |
− | <li><a class="dropbutton" href="/Team:Linkoping_Sweden/ | + | <a href="/Team:Linkoping_Sweden/Human_Practices" class="dropbutton">Human Practices</a> |
− | <li><a class="dropbutton" | + | <div class="dropdown-content"> |
− | + | <a href="/Team:Linkoping_Sweden/Human_Practices/Integrated">Integrated</a></div></li> | |
− | + | <li class="dropdown"> | |
+ | <a href="/Team:Linkoping_Sweden/Collaborations" class="dropbutton">Collaborations</a></li> | ||
+ | <li class="dropdown"> | ||
+ | <a href="/Team:Linkoping_Sweden/Team" class="dropbutton">Team</a></li> | ||
+ | <li class="dropdown"> | ||
+ | <a href="/Team:Linkoping_Sweden/Project" class="dropbutton">Project</a> | ||
+ | <div class="dropdown-content"> | ||
+ | <a href="/Team:Linkoping_Sweden/Model">Model</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Notebook">Notebook</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Design">Design</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Experiments">Experiments</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Results">Results</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Parts">Parts</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Safety">Safety</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Demonstrate">Demonstrate</a> | ||
+ | <a href="/Team:Linkoping_Sweden/Improve">Improve</a> | ||
+ | </div></li> | ||
+ | <li class="dropdown"> | ||
+ | <a href="/Team:Linkoping_Sweden/Attributions" class="dropbutton">Attributions</a> | ||
+ | <div class="dropdown-content"> | ||
+ | </div></li> | ||
</ul> | </ul> | ||
</nav> | </nav> |
Revision as of 09:26, 14 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602011, BBa_K2602014, BBa_K2602016, BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga