Line 11: | Line 11: | ||
<body> | <body> | ||
<header> | <header> | ||
− | <img src="https://static.igem.org/mediawiki/2018/ | + | <a href="https://2018.igem.org/Team:Linkoping_Sweden"> |
+ | <img src="https://static.igem.org/mediawiki/2018/a/af/T--Linkoping_Sweden--helvitlogo.png" alt="iGEM-logo" class="logo" </a> | ||
<nav> | <nav> | ||
<ul class="liu-menu"> | <ul class="liu-menu"> |
Revision as of 11:10, 14 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602011, BBa_K2602014, BBa_K2602016, BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga