Difference between revisions of "Team:Imperial College/Experiments"

Line 351: Line 351:
 
                 <div class="description">
 
                 <div class="description">
 
                     <p>This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475.
 
                     <p>This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475.
−
All characterization was performed using the FLUOstar BMG Labtech in greiner bioone F-bottom dark plates with clear bottom, to decrease fluorescence background.
+
All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background.
 
Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.
 
Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.
 
</p>
 
</p>
Line 444: Line 444:
 
   </tr>
 
   </tr>
 
</table>
 
</table>
−
<p>With a pipette tip pick a desired colony* from an agar plate and release the contaminated tip in the culture tip.  Place inoculated culture tubes in a 37° C in a shaking incubator overnight (for faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator should be of 45°)</p>
+
<p>With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator).  We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)</p>
  
 
<li>Prepare mastermixes (30 min)</li>
 
<li>Prepare mastermixes (30 min)</li>
−
<p>Mastermixes for each redox molecule concentration are prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.</p>
+
<p> Mastermixes for each redox molecule concentration prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.</p>
 
<p>Mastermizes for Day 1 and Day 2 :</p>
 
<p>Mastermizes for Day 1 and Day 2 :</p>
 
<table class="tg">
 
<table class="tg">
Line 583: Line 583:
 
   </tr>
 
   </tr>
 
</table>
 
</table>
 +
 +
<p> We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:</p>
 +
 +
<table class="tg">
 +
  <tr>
 +
    <th class="tg-xgv8">Condition</th>
 +
    <th class="tg-xgv8">Volume of A-H Mastermix (uL) </th>
 +
    <th class="tg-xgv8">Ampicillin (uL)</th>
 +
    <th class="tg-oyd9">Chloramphenicol (uL)</th>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-cify">PC1 + PC2</td>
 +
    <td class="tg-cify">406</td>
 +
    <td class="tg-cify">2.44</td>
 +
    <td class="tg-ksfr">0</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-cify">+</td>
 +
    <td class="tg-cify">203</td>
 +
    <td class="tg-cify">0</td>
 +
    <td class="tg-ksfr">2.44</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-ksfr">-</td>
 +
    <td class="tg-ksfr">203</td>
 +
    <td class="tg-ksfr">0</td>
 +
    <td class="tg-ksfr">0</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-ksfr">Blanks</td>
 +
    <td class="tg-ksfr">406</td>
 +
    <td class="tg-ksfr">2.44</td>
 +
    <td class="tg-ksfr">2.44</td>
 +
  </tr>
 +
</table>
 +
 +
This gave a total of 32 eppendorf tubes for Day 1 and 24 on Day 2, ready to be transferred into 96-well plates.
  
 
<li>Fill 96-well plate with media solutions</li>
 
<li>Fill 96-well plate with media solutions</li>
Line 724: Line 761:
 
</table>
 
</table>
 
<li>OD600 matching</li>
 
<li>OD600 matching</li>
−
<p>Once the cultures tubes in the shaking incubator appear cloudy, take them out and in a fresh microplate add 100 uL of each sample into a well. Add 100 uL of LB + antibiotic into a blank well. Take endpoint measurement of the filled wells and blank them with LB+antibiotic. Note down the OD600 value of the wells and dilute them to the desired initial OD600 (a value of 0.1 is suggested for a volume of 100 uL</p>
+
<p>After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL</p>
 
<p>Cell dilution calculator:
 
<p>Cell dilution calculator:
 
Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells
 
Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells
Line 730: Line 767:
 
</p>
 
</p>
 
<li>Add cells to 96-well plate</li>
 
<li>Add cells to 96-well plate</li>
−
<p>Pipette 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.</p>
+
<p>We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.</p>
 
<li>Set up the script in the plate reader and start experiment</li>
 
<li>Set up the script in the plate reader and start experiment</li>
 
<p>For Pyocyanin experiments:</p>
 
<p>For Pyocyanin experiments:</p>
−
<p>Set up a protocol that takes OD600 absorbance measurements and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). </p>
+
<p>We set up a script on the BMG Labtech Omega control software to perform endpoint  absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200. </p>
−
<p>For ferro/ferricyanide experiments:
+
 
−
</p>
+
−
<p>
+
−
For 200 uL of solution, we used a double orbital shaking rate of 200 rpm. Set temperature at 37°C.</p>
+
 
<li>Data analysis</li>
 
<li>Data analysis</li>
−
<p>Calculate mean and standard error for each set of replicates</p>
+
<p>We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments  </p>
  
 
</ol>
 
</ol>

Revision as of 04:01, 17 October 2018


Methods



Contents

Experiments

Assembling the Pixcell Constructs

Access All

Description

This protocol describes how to create the Pixcell construct and Pixcell construct with a degradation tag using Golden Gate assembly. Creating each of the constructs takes approximately two days

Materials

  • pBR322
  • E.coli MG1655 genomic DNA
  • GFP Storage Vector
  • 10µM of Primers
  • Q5 polymerase (New England Biolabs, #M0491)
  • 1% Agarose Gel
  • TAE Buffer
  • Monarch® DNA Gel Extraction Kit (NEB, #T1020S)
  • Golden Gate Assembly Mix (NEB, E1600S)
  • DJ901 and Turbo Cells
  • KCM
  • Phusion polymerase (NEB, #M0530S)
  • T4 DNA ligase (NEB, #M0202)

    • Notes
    Part Description
    pBR322 A medium copy vector encoding ampicillin resistance with a pMB1,origin of replication and a mcherry cassette with BsaI sites on either end.
    SoxRS The gene encoding the transcription factor Sox R and the bidirectional promoter pSoxS/pSoxR which it regulates
    GFP Superfolded GFP which is used as a reporter gene to be placed under the control of inducible side of the promoter, pSoxS

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Name Template Direction Function Tm (°C) Sequence
    PPC1 MG1655
    Genome
    		 Forward Amplification of SoxRS
    regulon    		 67.1 CTAGTGGGTCTCCCTCGAGAGAAAGACAAAGACCGG
    PPC2 MG1655
    Genome
    		 Reverse Amplification of SoxRS
    regulon    		 64 GTCGATGGTCTCCCATAAATCTGCCTCTTTTCAGTG
    PPC3 GFP Storage
    Vector    		 Forward Amplification of GFP 65 GTCGATGGTCTCGTATGCGTAAAGGCGAAGAA
    PPC4 GFP Storage Vector Reverse Amplification of GFP 68 CTAGTGGGTCTCGGGACAGTAGCGAAAAAACCCCG
    PPC5 PixCell Construct Forward Addition of a degradation
    tag to GFP in the PixCell Construct    		 65 GCAAACGACGAAACTACGCTTTAGTAATGATACTAGAGCGCAAAAAACCCC
    PPC6 PixCell Construct Reverse Addition of a degradation
    tag to GFP in the PixCell Construct    		 65 CTAAAGCGTAGTTTCGTCGTTTGCCTTATACAGCTCGTCCATACCGTGG
    1. PCR Reactions
      2. SoxRS regulon Amplification

      The PCR was carried out using the primers PPC1 and PPC2 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 59.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

    2. GFP Amplification.

      3. The PCR was carried out using the primers PPC3 and PPC4 and Q5 polymerase (New England Biolabs) following a protocol of 20 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 61.5 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension at 72 °C for 5 minutes.

    3. Gel Electrophoresis

      4. Both PCR product were run on a 1% agarose gel and extracted using the New England Biolabs gel extraction kit using the recommended protocol.

    4. Golden Gate Assembly

      5. The two amplicons were cloned into the pBR322 vector by adding 75ng of pBR322 and 30.1ng of SoxRS regulon and 23.4ng of GFP amplicon to the golden gate assembly mix (NEB, E1600S). Following the NEB protocol the mixture was incubated at 37°C for 1 hr and at 55°C, 5 mins.

    5. Transformation

      6. The PixCell construct was transformed into DJ901 and Turbo cells using the KCM heat shock protocol.

    6. Addition of the Degradation Tag

      7. Turbo cells containing the PixCell construct were grown overnight and miniprepped following the NEB protocol in order to obtain template DNA for the following PCR reaction. The PCR was carried out using the primers PPC5 and PPC6 and Phusion polymerase (New England Biolabs) with 3% DMSO. Following a protocol of 30 seconds of initial denaturation at 98 ºC, 30 cycles of 98 °C for 10 seconds, 65 °C for 30 seconds, and 72 °C for 3 minutes, and a final extension at 72 °C for 10 minutes. These primers produce complementary overhangs which when ligated together add a degradation tag we designed to the 3’ end of the coding region of GFP.

    7. Ligation

      8. The ends of the PCR amplicon produced from the primers PPC5 and PPC6 were ligated using T4 DNA ligase (NEB) following the recommended NEB protocol.

    8. Transformation

    9. The PixCell construct with deg tag was transformed into DJ901 cells using the KCM heat shock protocol.

    Characterizing Pixcell Constructs

    Access All

    Description

    This protocol describes how to measure E. coli growth and GFP expression over time with a plate reader, using the optical density at 600 nm as signal for cell density and excitation and emission wavelengths of 475. All characterization was performed using the FLUOstar BMG Labtech in Greiner Bio-One F-bottom dark plates with clear bottom, to decrease fluorescence background. Each cycle of this experiment takes two days and has to be repeated two days, in order to have 2 biological and 2 technical replicates, for a total of 4 days and 4 96-well plates used.

    Materials
    • Autoclaved LB media
    • Autoclaved 10x concentated LB media
    • 500 uM pyocyanin stock solution (from Sigma-Aldrich, CAS: No. 86-66-5)
    • 1250 mM potassium ferricyanide stock solution (from Sigma-Aldrich, CAS: No. 13746-66-2)
    • 500 mM ferrocyanide stock solution (from Sigma-Aldrich, CAS 14459-95-1 )
    • 2% Sodium Sulfite Solution
    • Agar plates with colonies of E. coli DJ901 strains with respective constructs: PixCell Patterning Circuit 1 (BBa_K2862021). PixCell Patterning Circuit 2 (BBa_K2862022), negative control (DJ901 WT) and positive control (constitutively expressed GFP).
    • 37°C shaking incubator
    • BMG Labtech FLUOstar plate reader
    • 4x Greiner BioOne 96-F 96-well microplate (black with clear bottom)
    • 14 mL culture tubes
    • autoclaved eppendorfs
    Notes

    Work in very sterile conditions. To prevent contaminations in the blanks, use triple antibiotics.
    Store pyocyanin and ferrocyanide and ferricyanide solutions in the freezer until use.
    We used 10x concentrated LB in order not to dilute nutrients at higher pyocyanin concentration; this was back diluted with autoclaved water. Mastemixes have double the working concentrations, as 100 uL of solution is then diluted with 100 uL of liquid cultures.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    1. Grow starter liquid cultures of cells (Day 0, 10-15 min preparation + overnight)

      2. Working in very sterile conditions, take 5 14mL culture tubes and prepare them according to table below:

      Label E. coli strain Construct Antibiotic (Ab) V Ab (uL) V LB (mL)
      PC1 DJ901 BBa_K2862021 Kan + Amp 5 + 5 5
      PC2 DJ901 BBa_K2862022 Kan + Amp 5 + 5 5
      - DJ901 none Kan 5 5
      + DJ901 GFP_Boo Kan + Chl 5 + 5 5
      Blanks None None Kan + Amp + Chl 5 + 5 5

      With a P20 pipette tip we picked the desired colonies from an agar plate and released the contaminated tip in the culture tip (for PC1, PC2 and Pos the picked colonies appeared fluorescence under a UV transilluminator). We then place inoculated culture tubes in a 37° C in a shaking incubator overnight. For faster growth the angle between the vertical axis of the tube and the shaking plane of the incubator was set at 45°)

    2. Prepare mastermixes (30 min)

      3. Mastermixes for each redox molecule concentration prepared in 1.5 mL eppendorfs. The mastermixes are enough to fill 2 96-well microplates with 100 uL of solutions in each well, in order to have two replicate of the same experiment. Take 8 autoclaved 1.5 mL eppendorfs and prepare them as described in the table below.

      Mastermizes for Day 1 and Day 2 :

      Condition V Pyo (uL) Kan (uL) LB 10x uL Autoclaved Water (uL) Tot Vol (uL)
      A = 0 uM Pyo 0 2.44 122 1098 1220
      B = 0.01 uM Pyo 0.0976 2.44 122 1097.9024 1220
      C = 0.025 uM Pyo 0.244 2.44 122 1097.756 1220
      D = 0.05 uM Pyo 0.488 2.44 122 1097.512 1220
      E = 0.1 uM Pyo 0.976 2.44 122 1097.024 1220
      F = 0.25 uM Pyo 2.44 2.44 122 1095.56 1220
      G = 0.5 uM Pyo 4.88 2.44 122 1093.12 1220
      H = 1 uM Pyo 9.76 2.44 122 1088.24 1220

      Mastermixes for Day 3 and Day 4:

      Condition V Pyo (uL) Kan (uL) LB 10x uL Autoclaved Water (uL) Tot Vol (uL)
      A = 2.5 uM Pyo 24.4 2.44 122 1073.6 1220
      B = 5 uM Pyo 48.8 2.44 122 1049.2 1220
      C = 10 uM Pyo 97.6 2.44 122 1000.4 1220
      D = 25 uM Pyo 244 2.44 122 854 1220
      E = 50 uM Pyo 488 2.44 122 610 1220
      F = 100 uM Pyo 976 2.44 122 122 1220

      We transferred master mixes into clean eppendorf tubes, with volumes specified below, to add the right antibiotics:

      Condition Volume of A-H Mastermix (uL) Ampicillin (uL) Chloramphenicol (uL)
      PC1 + PC2 406 2.44 0
      + 203 0 2.44
      - 203 0 0
      Blanks 406 2.44 2.44
      This gave a total of 32 eppendorf tubes for Day 1 and 24 on Day 2, ready to be transferred into 96-well plates.
    3. Fill 96-well plate with media solutions

      4. Add 100 uL of media in the desired wells, according following the label on mastermixes and table below:

      1 2 3 4 5 6 7 8 9 10 11 12
      A PC1 PC1 BA PC2 PC2 BA - - BA + + BA
      B PC1 PC1 BB PC2 PC2 BB - - BB + + BB
      C PC1 PC1 BC PC2 PC2 BC - - BC + + BC
      D PC1 PC1 BD PC2 PC2 BD - - BD + + BD
      E PC1 PC1 BE PC2 PC2 BE - - BE + + BE
      F PC1 PC1 BF PC2 PC2 BF - - BF + + BF
      G PC1 PC1 BG PC2 PC2 BG - - BG + + BG
      H PC1 PC1 BH PC2 PC2 BH - - BH + + BH
    4. OD600 matching

      5. After overnight growth, we diluted the all the cultures to an OD of 0.1. We diluted using a FLUOstar plate reader measuring single endpoint absorbance at 600 nm. We added 100 uL of LB + antibiotic into a blank well. We filled the the microplane with the cell culture solutions and took endpoint measurements of the filled wells and blanked them with the blank well. We note down the OD600 value of the wells and dilute them to tan OD600 of 0.1 according to the cell dilution calculator formula described below: (a value of 0.1 is suggested for a volume of 100 uL

      Cell dilution calculator: Volume of LB+Antibiotic to add in culture tube = [( Vcells * ODcell)/desired OD] - Vcells E.g. to dilute 5mL of cells at an OD600 of 0.3 to OD of 0.1 = [ (5mL*0.3)/0.1 - 5] =10 mL

    5. Add cells to 96-well plate

      6. We pipetted 100 uL of liquid cultures ot OD600= 0.1 into the corresponding wells,following 96-well microplate layout and culture tubes label.

    6. Set up the script in the plate reader and start experiment

      7. For Pyocyanin experiments:

      We set up a script on the BMG Labtech Omega control software to perform endpoint absorbance measurements at 600 nm and fluorescent intensity measurements every 10 minutes for 24 hours (288 cycles for 600 seconds cycles time). Both absorbance and fluorescence measurements were recorded from the bottom of the plate. The excitation/emission wavelengths for GFP detection was set up at 475-510 nm. The plate reader was set up to shake at a double orbital mode at an RPM of 200.

    7. Data analysis

      8. We exported the raw data excel spreadsheet and imported into MATLAB software. We calculated average OD600, standard deviation and standard errors (STDEV/SQRT(4), where 4 was our number of replicates. We performed the same calculations for fluorescence values. We divided fluorescence values at each time point by the corresponding OD600 values, to normalise GFP expression by the number of cells. We calculated standard deviations and standard errors analogously for OD600. We then plotted OD600 as a function of time, GFP/OD600. From these plots we identified the time at which cell growth and GFP expression reached a steady state and called this time T_survive. We then took the GFP/OD600 values at T_survive for each construct and plot them against pyocyanin concentration to plot concentration curves, as shown in the “Results” section. Similar analysis was performed for ferrocyanide and ferricyanide and PMS experiments

    Electrochemistry of Redox Modulators

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Spatial Electronic Control of Gene Induction

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Creating the Sox Library

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Characterising the Sox Library

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Testing Phenazine Methosulfate

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Biocontainment- Gp2 Growth Inhibition

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Fabric Bioprinting - Melanin

    Access All

    Description

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Materials

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Notes

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat. Lorem ipsum dolor, sit amet consectetur adipisicing elit. Competant cell protocol Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Lorem ipsum dolor, sit amet Heatshock protocol consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.

    Procedure

    Lorem ipsum dolor, sit amet consectetur adipisicing elit. Recusandae dolore, tenetur expedita in architecto, repellat rerum minima cumque exercitationem debitis laborum fugit aliquam quo molestiae. Alias eius nostrum aspernatur quaerat.