Difference between revisions of "Team:SDSZ China/Experiment A"

Revision as of 15:32, 17 October 2018

iGem SDSZ_China 2018

Obtaining Genes

Both fungal and bacterial acetylases have three functional domains- a deacetylase domain, a chitin binding zone, and a low density lipoprotein receptor region. By using the bioinformatics BLAST technique, a sequence highly conserved with known deacetylase domain sequences was searched in the NCBI soft armor gene database.

chitin deacetylase 1 [Penaeus monodon]

1 atggcaagag taagatgcgg tagttctctt gccctccttg gcattgtgct gccgagcggg
   61 tcaagaggca ggcagtttca gacacgaccg aggatggagc gaaccttcaa gagggaactg
121 tgcaaggata agggcgccgg cgagtggttc cgtctcagcc tcggtgactg tcgcgatgtg
181 atccagtgta ccgacgccgg tcttcaggcg ctgcgttgcc cccacggcct ggccttcaac
241 ctggagcagc agacctgcga ctggaaagcc aacgtcaaga actgcgacag gaaggagaag
301 acgaaggtcg tgaagcctct cttcaacacc gtcgagcccc tttgccagga aaaccagttg
361 gcgtgcggtg acggcacctg tctggatagg caggtcttct gtgatggaaa agaagattgt
421 accgatggtt ctgacgagac cgcatgtgac gtgaaaaatg accccaacag cgctcccatc
481 tgcaacaccg aggactgccg cctccccgat tgctactgct acaacgaccc tagcgagatg
541 ccccacaaca tgaagccttc cgaagtgcct cagatggtca ccatcacttt cgacgatgcc
601 atcaacatca acaacatgga cctgtacgag ctcatcttca agcagcgctt caaccccaac
661 ggctgctcca tcaagtccac cttcttcgtt tctcacaaat acaacaacta caccgccact
721 caggagatgc accgtctggg tcacgagatc gctgttcact ccatcaccca cgcaaacaac
781 gagactttct ggtcccacgc aagcgaagac gagtacgagc gcgaaatggg tggtgcccgc
841 gtcatcatcg aacgcttcgc caacatcacc gaccagtcca tcatcggcat gcgtaatccc
901 ttcctccgtg tgggcggcaa cagccagttc aggatgatgg agaagaacac cttcctgtac
961 gactccacca tcactgcccc cctgtcctcc atgcccctgt ggccctacac cctgtactac
   1021 cgcatgcccc acccctgcca tggaaacctc cagaactgcc ccactcgctc cttcgcagtg
   1081 tgggagatgg tcatgaacga gatggaccgt cgcgaggaac ccacttacga ggacggcctc
   1141 cccggatgcc acatggtcga ttcctgcttc gccaccaagc ccgagcccga gcagttctac
   1201 aacttcctgc agaacaactt caaccgccac tacaagtcaa accgcgctcc cttcggtctg
   1261 ttcttccact ctgccttcct gaagaacaac cccgacatcc tggacacctt cctctactgg
   1321 ctggacgaga ccctgaagaa ccagaaggac gtttacttcg tcaccatgac ccaggtcatc
   1381 cagtggatgc aggacccccg ccccgtcggc cagctgaaca actacgaggc ctggaaggag
   1441 aagtgcgtcg tcgacggccc acccttctgc tacggcggca acaactgcga gctggacact
   1501 gacgagctcc ctggccagac cctccacctg tccacctgca tgcggtgccc caacaattat
1561 ccctggacaa gggacccatt gggcgaggga ttcttctaa

PREDICTED: uncharacterized protein LOC108681649 [Hyalella azteca]

1 atgctgatgc atgtagccat catgctcatg ctgctggatc agcacgctca aggttcagag
   61 cggcaccccc ggcagagcag caacgccacc accacagagc agctctgcag aggccgcgac
121 tctgaggagt acttcagact ctctgccggc gacgactgca gagacgttgt tagatgtgac
181 cgcagtggac gctctggccc cagccgcctg gccgcagtgc ggtgccccaa cggcctcgcc
241 ttcgacgtcg acagacaagt ctgtgactgg aagaccaaag tccgcaactg cgacagactt
301 gagagaccgc ggaagattaa gccgctgctg gtgacggagg agccgctgtg ctcggggacg
361 gacctggcgt gcggcagcgg cgtgtgtgtc gccaaggagc tcttctgtga tggcaaacct
421 gactgtgatg acggttccga cgagaacacg tgtggtgtgg aagaagatcc aaaccgagcc
481 caggtgtgcg acaaaagtca atgcgttttg ccagaatgtt tctgttccgt ggacggcact
541 agaattcctg gtgatatcaa cccaaaacaa acaccgcaaa tgatcaccat cacattttca
601 ggagcaatca accttgataa tgtggatttg tacgatgaca tcttcaacgg ggaaagaaag
661 aatcccaacg gttgtcaagt gaaagcaacg ttcttcacgt cgcacaagta caccaattac
721 tccgcagttc aagaactaca caggaaaggc catgagatcg ctgtgttctc gatctcgaac
781 aaagaaagtc gagactattg gtcccatgga acatacgacg actggcttgc tgaaatggct
841 ggggccagac tcatcgtcga acgtttcgcc aatatcacag ataattccat cgtcgggtta
901 cgagcgccct acctcagggt tggaggaaac gctcagttcg acatgatgaa cgatcagttc
961 ttcttctacg acgcttcgat tacagcgcca ttggggaaac ttccgctatg gccgtacaca
   1021 ttgtacttca ggatgcctca caaatgtcac gggaacggcc aaaattgtcc atcacgctcc
   1081 caccccgtct gggaaatggt catgaacgaa atggacagaa gagacgaccc agagtttgac
   1141 gaaggactat ctgggtgtca ttacgtcgac tcctgcacca acatccggac tccaaagcaa
   1201 tttgcccatt tcctcgagca caacttcaga cgacactaca acacaaaccg tgcaccactc
   1261 ggcttgcatt tccacgcttc ttggctaaaa ggaaacaaaa attttaaaaa ggaactcatc
   1321 aatttcattc agtcaaaatc gggcaaccct gacgtgtatt tcgtgaccat gcttcaagtg
   1381 attcaatgga tgcaagcacc gaccgaagtg gcaggacttc gcgatttccc agaatggaag
   1441 gagaaatgcg acgtgcaagg tctgccattt tgctcattac caaacacttg cccggtgagg
   1501 acacgagaga ttcctgacga gactttgagt ttgttcacct gcatggactg cccccgcaac
   1561 tacccctggc tgctcgaccc taccggggat ggcgtggaaa ttatataa

PREDICTED: uncharacterized protein LOC108681651 [Hyalella azteca]

1 atgtctagat taagattcgt ccttgtgcta ttgttcgcag cagcggcagt cttagctgag
   61 gagcgtgaga agcgacaggc agcggaggcc gaggcgacgg tagacgagga tgccgtggac
121 gctttcacca gggagctgtg cgccagcaag ggcgcgcagg agtacttcag actcagcacg
181 caggattgca gaaaagtcat ccagtgcaca gaagtcggtc tggagagtct agtgtgcccc
241 cctagtcttg cattcgacct ggaactgcaa gcatgcaact ggaaggaaga ggtgaagaat
301 tgtgccaaga ccaccaaaga caagaaagtc aggcctctca ctgccaccaa ggaccccttg
361 tgcgagggcg gtaagctggc atgtggagac ggtgtgtgta tagcgaaaga gttgttctgc
421 gacggcaagc ctgactgtgc cgataattca gatgagaact tttgcgacat caactcagat
481 ccaaacagag ctcctcaatg taacaaggcc gaatgccagc tgccgaactg cttctgcatt
541 aacaacccta atgagacccc caacaatatc gaccctaagg atgtaccaca gatgatcatg
601 atcactttcg atgacgctgt caacaacaac aacgttgatc tctacgacct catcttcagt
661 ggccgcgcaa atccaaatgg ctgtgacatc aaagccacat tcttcgtgtc gcataaatac
721 acgaattaca ccgcagtcag cgaactacac cgcaaaggac acgaaatcgc cgtccactcc
781 atcagtcaca acgattccgc taccttctgg acggaagcca ctgtccaaga ctggaccaac
841 gaaatggcgg gagctcgaca gattgtcaat catttcgcca acatcactga taccacagtc
901 gtgggcgtcc gcgctcctta ccttcgagtg ggaggaaaca accaattcct catgatggaa
961 gagcaaggtt tcctctacga ttccaccatt gttgctcctt tggctgatgt gccactttgg
   1021 ccctatattt tgtactaccg tatgcctcat gagtgtcatg ggcacattca ggtttgccct
   1081 actcgggcat acgctgtttg ggaaatggtc atgaacgaaa tggaccgtcg tgaagaccct
   1141 cttcatgaag agcctcttcc tggttgcgct atggtggact cctgcttctc gaacaggccg
   1201 acaggcgatc aattttataa tttcttgaac aacaacttca accgccacta caactccaac
   1261 cgcgctccta tgggactctt tttccactct gctttcctca agaacaaccc tgagatcctg
   1321 gatgccttta cgttctggct cgacgaaatt cttagcactc acaaggacgt ctacttcgta
   1381 accatgactc aagctcttta ctggctccag gatattgttc caattagtca agttgctaac
   1441 ttcgagccct ggaaggataa gtgtgcagtc caaggccctc catcgtgcca gaacggagga
   1501 aataactgta aattggacac tgctgaactg cccggcgaaa ccgtacgcct gtctacctgc
   1561 atgccttgcc ccagcaggta cccctggttg ttggacccca atggtgatgg actattctaa

Verm

1 atgctgaccg ttgatggagc agtgaacgac ctgaactatg aaacctacag cagcgtcttc
61 cgccccgatc gcaccaaccc caatggctgc cctatccgag gcaccttctt tgtctcccat
121 gagtacacca actaccagca gggggaggac ctctacagca gagggcacga gattgctgtt
181 ggctccgtca gccgccgtgc cggtctagag gatgaagggg aagagtcctg gactggagag
241 atggtgacaa tgcgagaaat tcttactaaa tttgctggag tgcgcactga ggatctgaag
301 ggacagcgag gacctcacct caagcctggc agggaggctc agtatgaggt gctcagtgcc
361 tatgggttca cttgggactc taccatcaac aaccctccca caaaacacct agtttggccc
421 tactccctgg aatgcaagat gccccatgag tgccgagctg gttcctgccc cacacgatcc
481 ttccccggag tgtgggagct gcctatgaac tcccacttca aggacaccag tttccaggga
541 ggcttttgcc cttacctgga ccagtgcaac ttcagctact ag

Inserting expression vector

Choosing prokaryotic expression vector (pET-28a)

Designing primers and restriction sites

Chitin deacetylase 1 p5 GGATCCATGGCAAGAGTAAGATGCGG
Chitin deacetylase 1 p3 AAGCTTTTAGAATCCCTCGCCC

LOC108681649 p5 GGATCCATGCTGATGCATGTAGCCATC
LOC108681649 p3 AAGCTTTTATATAATTTCCACGCCATCC

LOC 108681651 p5 GGATCCATGTCTAGATTAAGATTCGTCC
LOC 108681651 p3 AAGCTTTTAGAATAGTCCATCACCATTGG

Verm p5 CGCGGATCCATGCTGACCGTTGAT
Verm p3 GATTCGTGGTAGCTGAAGTTGCACTGGTC

ChinB p5 CTTCAGCTACACCACGAATCCGGGTGTTAGC
ChinB p3 CCGGAATTCCTACTGGAGTTGCCAC

The restriction enzyme cutting sites of our experiment are BamH I (198) and Hind III (173)

Transfection

The plasmid was diluted 1000-fold and 10000-fold, and the competent bacteria BL-21 was added for 30 minutes in an ice bath. Then we heated the bacteria at 42 degrees for one minute, and ice-bathed for five more minutes. After that, we added 400 ml of LB without Kana antibiotic and shook the bacterial fluid. Finally, the bacteria were sprayed on a petri dish with kana antibiotics.

Bacterial Fluid PCR to filter positive clones

To insure the plasmids were successfully transfected, we conducted bacterial fluid PCR. Our groupmates take ten 1.5 ml EP tubes, add 200 μl of kana resistant medium separately, directly draw a single clone with a small pipette tip and push the TIP directly into an EP tube. We covered the EP tube and shake the bacteria at 37 degrees for 2-3 hours. Then 1μl of the bacterial solution was used as a template to identify the PCR positive clone. DNA gel electrophoresis was used to see if there was a target strip to judge.

Inducing Expression

We set up various conditions to discover the most effecient condition. In total, we induced the sample in 180 different conditions. The samples are divided into different groups- the experiment group and the control group

Detecting Ability

Page electrophoresis

When the bacteria were induced, the page electrophoresis is necessary to identify whether the protein could be expressed successfully or not.

Measuring Enzyme Abilities

We add 1 mL 200 m g / L of substrate to a clean test tube, 3mL 0.05 mol / L phosphate buffer , 3 min 50 ° C water bath temperature protection Min, and add 1 mL enzyme solution, mix and heat in 50 degrees water 15 min. After that, we used boiling water to terminate the enzymatic reaction, and add water to a volume of 10 mL. Evenly, the solution was centrifuged at 3000r /min for 10 min. Measure the OD value of the upper clear. Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity ( U /mL ).

References

Ding Guowei. Molecular characteristics and functional analysis of chitin deacetylase genes inOxya chinensis(Orthoptera:Acrididae). MS thesis. university of Shan Xi, 2015. Tokuyasu, Ken, Mayumi Ohnishi-Kameyama, and Kiyoshi Hayashi. "Purification and characterization of extracellular chitin deacetylase from Colletotrichum lindemuthianum." Bioscience, biotechnology, and biochemistry 60.10 (1996): 1598-1603. ElMekawy, Ahmed, et al. "Kinetic properties and role of bacterial chitin deacetylase in the bioconversion of chitin to chitosan." Recent patents on biotechnology 7.3 (2013): 234-241.

@@ Line 313: / Line 313: @@
 <p style="color:black;font-size:35px;">
-When the bacteria was induced, the page electrophoresis is necessary to indentify whether the protein could be expressed successfully or not.
+When the bacteria were induced, the page electrophoresis is necessary to identify whether the protein could be expressed successfully or not.
 </p>
   <header class="align-center">
@@ Line 321: / Line 321: @@
 <p style="color:black;font-size:35px;">
 We add 1 mL 200 m g / L of substrate to a clean test tube, 3mL 0.05 mol / L phosphate buffer , 3 min 50 ° C water bath temperature protection Min, and add 1 mL enzyme solution, mix and heat in 50 degrees water 15 min. After that, we used boiling water to terminate the enzymatic reaction, and add water to a volume of 10 mL. Evenly, the solution was centrifuged at 3000r /min for 10 min. Measure the OD value of the upper clear.
-Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity  ( U /m L ).
+Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity  ( U /mL ).
 </p>
 </div>