Line 108: | Line 108: | ||
</tr> | </tr> | ||
</table> | </table> | ||
− | + | <div class="line-separator"></div> | |
</section> | </section> | ||
</body> | </body> | ||
</html> | </html> |
Revision as of 15:57, 19 September 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts:
- Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026
- Verified biobrick: BBa_I746909
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga
Name | Marker | Class | Promoter | Insert |
---|---|---|---|---|
pGroE7 | Chloramphenicol | B | pBAD | GroE |
pG-KJE8 | Chloramphenicol | B | pBAD | GroE, DnaKJE |
pG-Tf2 | Chloramphenicol | B | pBAD | GroE, Tf |
pEGFP-Tau | Kanamycin | A | T7 | EGFP-Tau |
pEGFP-Aβ | Kanamycin | A | T7 | EGFP-Aβ |
pSB4A5-GroES | Ampicillin | C | pTet | GroES |