Difference between revisions of "Team:Linkoping Sweden/Parts"
| Line 37: | Line 37: | ||
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4> | This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.</h4> | ||
<ul> | <ul> | ||
| − | <li>Composite parts: BBa_K2671420</li> | + | <li><b>Composite parts:</b> BBa_K2671420</li> |
| − | <li>Basic Parts: BBa_K2671337</li> | + | <li><b>Basic Parts:</b> BBa_K2671337</li> |
| − | <li>Improved parts: </li> | + | <li><b>Improved parts:</b> </li> |
| − | <li>Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026</li> | + | <li><b>Verified collaboration parts:</b> K2602011, K2602014, K2602016, K2602021, K2602024, K2602026</li> |
| − | <li>Verified biobrick: BBa_I746909 | + | <li><b>Verified biobrick:</b> BBa_I746909 |
</ul> | </ul> | ||
<h4> | <h4> | ||
Primers used for all our experiments can be found below.</h4> | Primers used for all our experiments can be found below.</h4> | ||
<ul> | <ul> | ||
| − | <li>Vector reverse (VR): attaccgcctttgagtgagc </li> | + | <li><b>Vector reverse (VR):</b> attaccgcctttgagtgagc </li> |
| − | <li>Vector forward 2 (VF2): tgccacctgacgtctaagaa </li> | + | <li><b>Vector forward 2 (VF2):</b> tgccacctgacgtctaagaa </li> |
| − | <li>Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat </li> | + | <li><b>Backbone SNP reverse (BSNPR):</b> ctctagaagcggccgcgaat </li> |
| − | <li>Backbone ENX forward (BENXF): tactagtagcggccgctg </li> | + | <li><b>Backbone ENX forward (BENXF):</b> tactagtagcggccgctg </li> |
| − | <li>Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg </li> | + | <li><b>Liu iGEM17 site directed mutagenesis reverse (SDMR):</b> cccgaaccgctttacttg </li> |
| − | <li>Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac </li> | + | <li><b>Liu iGEM17 site directed mutagenesis forward (SDMR):</b> ctcaggaagcactagtggctcggac </li> |
| − | <li>Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga</li> | + | <li><b>Liu iGEM17 mNG forward (mNG-F):</b> ggactggtgcaggtcgaaga</li> |
</ul> | </ul> | ||
</div> | </div> | ||
Revision as of 16:34, 19 September 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts site on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts:
- Verified collaboration parts: K2602011, K2602014, K2602016, K2602021, K2602024, K2602026
- Verified biobrick: BBa_I746909
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc
- Vector forward 2 (VF2): tgccacctgacgtctaagaa
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat
- Backbone ENX forward (BENXF): tactagtagcggccgctg
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga
| Name | Marker | Class | Promoter | Insert |
|---|---|---|---|---|
| pGroE7 | Chloramphenicol | B | pBAD | GroE |
| pG-KJE8 | Chloramphenicol | B | pBAD | GroE, DnaKJE |
| pG-Tf2 | Chloramphenicol | B | pBAD | GroE, Tf |
| pEGFP-Tau | Kanamycin | A | T7 | EGFP-Tau |
| pEGFP-Aβ | Kanamycin | A | T7 | EGFP-Aβ |
| pSB4A5-GroES | Ampicillin | C | pTet | GroES |