Difference between revisions of "Team:Linkoping Sweden/Parts"
| Line 75: | Line 75: | ||
Primers used for all our experiments can be found below.</h4> | Primers used for all our experiments can be found below.</h4> | ||
<ul> | <ul> | ||
| − | <li><b>Vector reverse (VR):</b> attaccgcctttgagtgagc </li> | + | <li><b>Vector reverse (VR):</b> attaccgcctttgagtgagc </li> (used for sequencing and colony screening) |
| − | <li><b>Vector forward 2 (VF2):</b> tgccacctgacgtctaagaa </li> | + | <li><b>Vector forward 2 (VF2):</b> tgccacctgacgtctaagaa </li> (used for sequencing and colony screening) |
| − | <li><b>Backbone SNP reverse (BSNPR):</b> ctctagaagcggccgcgaat </li> | + | <li><b>Backbone SNP reverse (BSNPR):</b> ctctagaagcggccgcgaat </li> (used to amplify pSB4A5 from the distributed plates) |
| − | <li><b>Backbone ENX forward (BENXF):</b> tactagtagcggccgctg </li> | + | <li><b>Backbone ENX forward (BENXF):</b> tactagtagcggccgctg </li> (used to amplify pSB4A5 from the distributed plates) |
| − | <li><b>Liu iGEM17 site directed mutagenesis reverse (SDMR):</b> cccgaaccgctttacttg </li> | + | <li><b>Liu iGEM17 site directed mutagenesis reverse (SDMR):</b> cccgaaccgctttacttg </li> (used for the improvement) |
| − | <li><b>Liu iGEM17 site directed mutagenesis forward (SDMR):</b> ctcaggaagcactagtggctcggac </li> | + | <li><b>Liu iGEM17 site directed mutagenesis forward (SDMR):</b> ctcaggaagcactagtggctcggac </li> (used for the improvement) |
| − | <li><b>Liu iGEM17 mNG forward (mNG-F):</b> ggactggtgcaggtcgaaga</li> | + | <li><b>Liu iGEM17 mNG forward (mNG-F):</b> ggactggtgcaggtcgaaga</li> (used for colony screening of the improvement) |
</ul> | </ul> | ||
</div> | </div> | ||
Revision as of 08:23, 15 October 2018
Parts
All parts
Collection
This is a collection of all parts we worked with, for more information about the parts, their function and results, please visit the results page or the parts homepage on parts.igem.org.
- Composite parts: BBa_K2671420
- Basic Parts: BBa_K2671337
- Improved parts: BBa_K2671000
- Verified collaboration parts: BBa_K2602011, BBa_K2602014, BBa_K2602016, BBa_K2602021, BBa_K2602024, BBa_K2602026
- Verified biobrick: BBa_I746909, BBa_K173007
Primers used for all our experiments can be found below.
- Vector reverse (VR): attaccgcctttgagtgagc (used for sequencing and colony screening)
- Vector forward 2 (VF2): tgccacctgacgtctaagaa (used for sequencing and colony screening)
- Backbone SNP reverse (BSNPR): ctctagaagcggccgcgaat (used to amplify pSB4A5 from the distributed plates)
- Backbone ENX forward (BENXF): tactagtagcggccgctg (used to amplify pSB4A5 from the distributed plates)
- Liu iGEM17 site directed mutagenesis reverse (SDMR): cccgaaccgctttacttg (used for the improvement)
- Liu iGEM17 site directed mutagenesis forward (SDMR): ctcaggaagcactagtggctcggac (used for the improvement)
- Liu iGEM17 mNG forward (mNG-F): ggactggtgcaggtcgaaga (used for colony screening of the improvement)