Difference between revisions of "Team:Duke/Basic Part"
| Line 4: | Line 4: | ||
<h1>BAPT</h1> | <h1>BAPT</h1> | ||
<p><br> | <p><br> | ||
| − | ===Name: === | + | ===Name: ===<br> |
| − | + | Phenylpropanoyltransferase (BAPT, TAX7) | |
| − | <br> | + | <br><br> |
| − | ===Reaction: === | + | ===Reaction: === <br> |
baccatin III + (3R)-3-amino-3-phenylpropanoyl-CoA → N-debenzoyl-(3'-RS)-2'-deoxytaxol + coenzyme A | baccatin III + (3R)-3-amino-3-phenylpropanoyl-CoA → N-debenzoyl-(3'-RS)-2'-deoxytaxol + coenzyme A | ||
| − | <br> | + | <br><br> |
| − | ===Km: === | + | ===Km: ===<br> |
5.6 uM for (3R)-3-amino-3-phenylpropanoyl-CoA; | 5.6 uM for (3R)-3-amino-3-phenylpropanoyl-CoA; | ||
68 uM for baccatin III; | 68 uM for baccatin III; | ||
2.4 uM for baccatin III and 4.9 uM beta-phenylalanoyl-CoA (Thornburg, 2015) | 2.4 uM for baccatin III and 4.9 uM beta-phenylalanoyl-CoA (Thornburg, 2015) | ||
| − | <br> | + | <br><br> |
| − | ===Kcat: === | + | ===Kcat: ===<br> |
0.0583 ± 0.0010 s<sup>-1</sup> (Thornburg, 2015) | 0.0583 ± 0.0010 s<sup>-1</sup> (Thornburg, 2015) | ||
| − | <br> | + | <br><br> |
| − | ===Enzyme Description: === | + | ===Enzyme Description: ===<br> |
BAPT is the enzyme that adds the C13 Taxol side chain partially formed to the Taxol backbone. It makes use of <br> | BAPT is the enzyme that adds the C13 Taxol side chain partially formed to the Taxol backbone. It makes use of <br> | ||
CoA chemistry to add the side chain to the 13’ hydroxyl group of baccatin III. | CoA chemistry to add the side chain to the 13’ hydroxyl group of baccatin III. | ||
| − | <br> | + | <br><br> |
| − | ===Sequence=== | + | ===Sequence===<br> |
atgaagaagactgggagtttcgcggagttccacgttaatatgatcgagcgcgtgatggttcgtccttgccttccttcacctaagactattttgcctttgt | atgaagaagactgggagtttcgcggagttccacgttaatatgatcgagcgcgtgatggttcgtccttgccttccttcacctaagactattttgcctttgt | ||
ctgcgatcgataacatggcacgtgccttcagtaatgtcttactggtgtacgccgccaacatggatcgcgtcagcgcggacccggcaaaggttattcgtga | ctgcgatcgataacatggcacgtgccttcagtaatgtcttactggtgtacgccgccaacatggatcgcgtcagcgcggacccggcaaaggttattcgtga | ||
| Line 42: | Line 42: | ||
ttgcaatcgaccaagaatatgcctgacggtatcaagatgttaatgtttatgcctcctagtaaacttaagaaatttaagattgaaatcgaagccatgatta | ttgcaatcgaccaagaatatgcctgacggtatcaagatgttaatgtttatgcctcctagtaaacttaagaaatttaagattgaaatcgaagccatgatta | ||
agaaatatgttacgaaggtatgcccttctaagctttgataa | agaaatatgttacgaaggtatgcccttctaagctttgataa | ||
| + | <br><br> | ||
| − | ===Design Notes=== | + | ===Design Notes===<br> |
Part digested from vector designed by Duke's 2016 team. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-HC-Amp vector. | Part digested from vector designed by Duke's 2016 team. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-HC-Amp vector. | ||
| − | <br> | + | <br><br> |
| − | ===Source=== | + | ===Source===<br> |
Origin from Pacific Yew Tree, Taxus brevifolia | Origin from Pacific Yew Tree, Taxus brevifolia | ||
| − | <br> | + | <br><br> |
| − | ===References=== | + | ===References===<br> |
Thornburg, C. (2015). Development of a four-step semi-biosynthesis of the anticancer drug paclitaxel and its analogues (Doctoral dissertation, Michigan State University). | Thornburg, C. (2015). Development of a four-step semi-biosynthesis of the anticancer drug paclitaxel and its analogues (Doctoral dissertation, Michigan State University). | ||
<br> </p> | <br> </p> | ||
Revision as of 20:01, 17 October 2018
BAPT
===Name: ===
Phenylpropanoyltransferase (BAPT, TAX7)
===Reaction: ===
baccatin III + (3R)-3-amino-3-phenylpropanoyl-CoA → N-debenzoyl-(3'-RS)-2'-deoxytaxol + coenzyme A
===Km: ===
5.6 uM for (3R)-3-amino-3-phenylpropanoyl-CoA;
68 uM for baccatin III;
2.4 uM for baccatin III and 4.9 uM beta-phenylalanoyl-CoA (Thornburg, 2015)
===Kcat: ===
0.0583 ± 0.0010 s-1 (Thornburg, 2015)
===Enzyme Description: ===
BAPT is the enzyme that adds the C13 Taxol side chain partially formed to the Taxol backbone. It makes use of
CoA chemistry to add the side chain to the 13’ hydroxyl group of baccatin III.
===Sequence===
atgaagaagactgggagtttcgcggagttccacgttaatatgatcgagcgcgtgatggttcgtccttgccttccttcacctaagactattttgcctttgt
ctgcgatcgataacatggcacgtgccttcagtaatgtcttactggtgtacgccgccaacatggatcgcgtcagcgcggacccggcaaaggttattcgtga
ggcgcttagcaaggtattggtctactattacccttttgctggccgcttgcgtaacaaagaaaatggagagcttgaagtggagtgcacaggacaaggagta
ttgtttttagaagccatggctgacagcgacctttcagtattaactgacctggacaactacaatcctagttttcagcagcttatctttagcttgccgcaag
ataccgacatcgaggatttgcatttgttgatcgtacaggtcacacgcttcacatgtggtgggtttgttgtcggtgctaacgtctatggttccgcctgtga
cgcaaaaggattcggtcaattcttacagtctatggcggagatggctcgcggagaagtaaagccctccatcgaaccaatctggaatcgcgaattggttaaa
cttgagcactgtatgccttttcgtatgtcacacttgcagattattcacgcgccagtcattgaggagaagtttgtccagacatcgcttgtgatcaacttcg
aaatcatcaaccatattcgtcgtcgcatcatggaagagcgtaaagagagcctgtcttctttcgaaattgttgccgcgttagtctggcttgcgaagattaa
ggcgtttcaaattccacattccgaaaatgtgaaactgctgttcgccatggacctgcgccgctctttcaatccgccgctgccccatgggtattatgggaat
gcatttgggatcgcttgcgcgatggacaacgtgcatgatctgttgtcgggtagcctgttgcgtaccattatgatcattaagaagtctaaattttccctgc
ataaagaattaaattctaagacagttatgagtagttccgtagtggatgtaaataccaaatttgaggacgttgtgtcgatctccgactggcgccacagcat
ttactacgaagtagactttggatggggagacgcaatgaatgtgagtacgatgcttcagcaacaagaacacgaaaaatcgctgccaacgtattttagtttt
ttgcaatcgaccaagaatatgcctgacggtatcaagatgttaatgtttatgcctcctagtaaacttaagaaatttaagattgaaatcgaagccatgatta
agaaatatgttacgaaggtatgcccttctaagctttgataa
===Design Notes===
Part digested from vector designed by Duke's 2016 team. Original vector constructed by Gibson Assembly of BAPT Gblock into pSMART-HC-Amp vector.
===Source===
Origin from Pacific Yew Tree, Taxus brevifolia
===References===
Thornburg, C. (2015). Development of a four-step semi-biosynthesis of the anticancer drug paclitaxel and its analogues (Doctoral dissertation, Michigan State University).