Day 1, Monday 11/06

People In Lab:Amalia, Carla, Daniel, Jasmeen, Nina, Tashi

Agenda:

• Transform 2J interlab plasmid into DH5α and plate on LB+CAM

• LB+CAM plates

• Interlab calibration #2: Particle Standard Curve - Microsphere Protocol

• Electroporate MG1655ΔlacI

• Transform pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI

• Make and autoclave PBS for interlab calibration #3

• Autoclave double distilled water

Equipment used:

• Autoclave

• Bunsen burner

• Plate reader

• Thermomixer

• 37°C incubator in room 301

• Electroporator

Protocol: iGEM protocols used for transformation, electroporation, LB+agar. Interlab protocol used for Interlab calibration #2: Particle Standard Curve - Microsphere Protocol.

Transformation of 2J plasmid

1μLof 2J plasmid used, 50μLof cells plated

Interlab calibration #2

• 200μLbead stock in wells A1, B1, C1, D1

• 100μLdouble distilled water in wells A2-A12, B2-B12, C2-C12, D2-D12

• performed serial dilution by transferring 100μLeach time, until well A11, B11, C11, D11

• used the plate reader to shake the plate at an amplitude of 3.5 for 7 seconds, and measure the absorbance at wavelength 600nm

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI

• 2μLof pSB1C3+RFP(10pg/μL)

• 1μLofpET28a+arg1

• plated 100μLon LB+CAM+KAN

• plated 200μLon LB+CAM+KAN

• plated 300μLon LB+CAM+KAN

• plated negative control (100μLof untransformed MG1655ΔlacI)

Next Steps:

• Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

• Interlab cell measurement protocol

Day 2, Tuesday 12/06

People In Lab: Amalia, Carla, Daniel, Nina

Agenda:

• Second attempt at pSB1C3+RFP and pET28a+arg1 double transformation in MG1655ΔlacI, testing for incompatibility

• Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

• Make overnight cultures from interlab transformation plates

Equipment used:

• Bunsen burner

• Plate reader

• Electroporator

• Shaker in room 315

• 37°C incubator in room 301

Protocol: iGEM protocols used for transformation by electroporation. Interlab protocol used for for Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI (electroporation)

Hypothesis: If we get growth on the positive control, LB+KAN, and LB+CAM plates with transformed cells, but not the double antibiotic plate, we can say that either the plasmids are incompatible, or the double antibiotic plate concentration is too high.

• 1.5μLof RFP (50pg/μL)

• 1.5μLof pET28a+arg1

• plated 150μLof transformed cells on LB+CAM+KAN

• plated 100μLof transformed cells on LB+CAM

• plated 100μLof transformed cells on LB+KAN

• plated 10μLof untransformed cells on LB+KAN (negative control)

• plated 10μLof untransformed cells on LB (positive control)

Interlab calibration #3

• serial dilution was performed and the plate was read

• shaken 5s at amplitude = 2

• excitation = 485nm

• emission = 525nm

• optimal gain used = 75

• read from bottom of plate

• The graph obtained from this experiment indicated an error, will repeat tomorrow

Interlab transformation overnight cultures

• 16 tubes with 5mL of LB and 5μLCAM

• 2 colonies were taken from each of the 8 plates (2B, 2D, 2F, 2H, 2J, 2L, 2N, 2P)

• tubes placed in the shaker overnight at 37° at 250rpm

Observations:

Double transformation of pSB1C3+RFP and pET28a+arg1 into MG1655ΔlacI

• no colonies on negative control plate

• no colonies on 100μL, 200μL, or 300μLplates

100μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI (negative control) on LB+CAM+KAN

100μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

200μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

300μL double transformation of pSB1C3+RFP (10pg/μL) and pET28a+arg1 in MG1655ΔlacI on LB+CAM+KAN

Potential reasons for results:

• antibiotic concentration too high (50μL/mL KAN + 25μL/mL CAM)

• MG1655ΔlacIcells may no longer be competent

• left MG1655ΔlacIcells thawing in the ice for too long

• electroporation might have failed

• plasmids may not have been compatible

• we could try sequential transformation (still have to consider antibiotic concentration of LB+KAN+CAM plate)

Next Steps:

Finish Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

Cell growth, sampling, assay (interlab cell measurement)

Day 3, Wednesday 13/06

People In Lab:Amalia, Carla, Daniel, Nina

Agenda:

• Redo Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

• Autoclave glass bottles, beads, tips, eppendorf tubes

• Reculture the overnight cultures from the interlab transformation

Equipment used:

• Autoclave

• Bunsen burner

• Plate reader

• 37°C shaker in room 315

Protocol: Used interlab protocol for interlab calibration.

Second attempt at Interlab calibration #3: Fluorescence standard curve - Fluorescein Protocol

• serial dilution was performed and the plate was read

• excitation = 485nm

• emission = 525nm

• optimal gain used = 90

• read from bottom of plate

Reculturing the overnight cultures from the interlab transformation

• 16 tubes with 5mL of LB and 5μLCAM

• 100μLfrom each previous overnight culture placed in respective new tube (DH5α)

• tubes slightly unscrewed and tape placed on lid for aeration in shaker

• tubes placed in the shaker overnight at 37°C at 250rpm

Observations:

Second double transformation pSB1C3+RFP and pET28a+arg1in MG1655ΔlacI

• LB+CAM+pSB1C3+RFP and pET28a+arg1

  • sparsely populated pink colonies

  • presence of some colonies

• LB+KAN+pSB1C3+RFP and pET28a+arg1

  • no visible colonies

• LB+KAN+CAM+pSB1C3+RFP and pET28a+arg1

  • no visible colonies

• LB+KAN+nontrasformed cells (negative control)

  • no visible colonies

• LB+nontransformed cells (positive control)

  • growth on entire plate

Second double transformation pSB1C3+RFP and pET28a+arg1 in MG1655ΔlacI

Potential reasons for these results:

• colonies on LB+CAM+pSB1C3+RFP+pET28a+arg1) because the cells are still competent and were transformed with pSB1C3+RPF

• no colonies on LB+KAN+pSB1C3+RFP and pET28a+arg1not because the cells are not competent, but rather the transformation (pET28a+arg1into MG1655ΔlacI) failed

• no colonies on LB+KAN+CAM+pSB1C3+RFP+pET28a+arg1 because the backbones are not compatible

• no growth on LB+KAN+non transformed cells (negative control) because there was no antibiotic resistance gene in the cells

• we had growth on LB+non transformed cells (positive control) because the cells were viable and there was no selection in the plate against them

  • pET28a = KAN resistant - incompatible with pSB1C3 by group check

  • pSB1C3 = CAM resistant - higher copy number than pET28a

Next Steps:

Finish interlab cell measurement protocol

Day 4, Thursday 14/06

People In Lab:Ahmed, Amalia, Daniel, Monica, Nina, Tashi

Agenda:

• Interlab cell measurement protocol

• Autoclave P1000 tips

• LB media

• LB+CAM plates

Equipment used:

• Autoclave

• Plate reader

• Shaker in autoclave room

• Bunsen burner

• 37°C incubator in room 301

Protocol: iGEM protocols used for LB, LB+agar. Interlab protocols used for interlab OD and CFU measurements.

Observations:

Next Steps:

• Count colonies on CFU cell measurement plates for interlab cell measurement protocol

• Transform pET28a+arg1intoMG1655ΔlacI cells

Day 5, Friday 15/06

People In Lab:Ahmed, Amalia, Nina, Tashi

Agenda:

• Check overnight plated cultures for interlab CFU count

• Transformation of pET28a+arg1 into electrically competent MG1655ΔlacIcells

Observations:

Interlab CFU count

Miniscule colonies on some plates after ~11 hours of incubation at 37°C. Some plates did not have any colonies. Plates were put back in the incubator for a few more hours.

Equipment used:

• 37°C incubator in room 301

• Shaker in room 315

• Electroporator

Protocol: iGEM protocols used for transformation by electroporation.

Transformation of ARG1 in electrically competent MG1655ΔlacIcells

• pET28a+arg1diluted from 39.3ng/mL to 1ng/mL

  • 38.3μLnuclease free water + 1μLpET28a+arg1

• transformed cells in cuvette placed in shaker at 37°C, 250rpm

• 3 plates

  • 40μLof untransformed MG1655ΔlacIcells (negative control)

  • 100μLof MG1655ΔlacItransformed with pET28a+arg1

  • 200μLof MG1655ΔlacItransformed with pET28a+arg1

Next Steps:

• Redo Calibration #2: Particle Standard Curve - Microsphere Protocol

• Overnight culture of 2B (2 colonies) and 2D (2 colonies) in DH5α

• If pET28a+arg1 transformation works

  • 2 MG1655ΔlacI overnight cultures (LB+KAN+IPTG)

  • 2 MG1655ΔlacI overnight cultures (LB+KAN)

  • streak a single MG1655ΔlacIcolony on an LB+KAN plate

Day 1, Monday 18/06

People In Lab: Amalia, Daniel, Jasmeen, Nina, Tashi

 

Agenda:

• LB+CAM plates
• Overnight culture of 2B (2 colonies) and 2D (2 colonies) (DH5α) for interlab
• 2 overnight cultures of LB+KAN+MG1655ΔlacI+IPTG
• 2 overnight cultures of LB+KAN+MG1655ΔlacI
• Streak plate pET28a+arg1 transformation on LB+KAN to get single colonies (MG1655ΔlacI)
• Autoclave microcentrifuge tubes

 

Equipment used:

• Autoclave
• Bunsen burner
• Shaker in room 315

 

Protocol: iGEM protocols used for LB+agar

 

Overnight cultures of colonies 2B+2D for interlab CFU

-4 LB+CAM tubes each with 5mL LB+5μL CAM

-2 colonies taken from 2B plate and inoculated

-2 colonies taken from 2D plate and inoculated

-all tubes placed in the shaker at 37°C at 250rpm

 

Serial dilution of IPTG

-dilution 1: 30μL of 1M IPTG stock in 10mL of LB = conc. 3mM

-10μL of dilution 1 in 10mL of LB = conc. 3μM

 

Overnight cultures of pET28a+arg1

-4 tubes

-2 with 5mL LB+IPTG+25μL KAN

-2 with 5mL LB+25μL KAN

-all tubes placed in the shaker at 37°C at 250rpm

 

Observations:

pET28a+arg1 transformation into MG1655ΔlacI

-No colonies on negative control plate or 100μL plate of transformed cells

-2 blobs on the 200μL plate of transformed cells

 

pET28a+arg1 transformation into MG1655ΔlacI negative control - 40μL untransformed cells

pET28a+arg1 transformation into MG1655ΔlacI 100μL transformed cells

pET28a+arg1 transformation into MG1655ΔlacI 200μL transformed cells

CFU colony count

		Colony 1				Colony 2
2B	dilution 3	210	201	224		134	0	300
	dilution 4	*	*	*		*	*	*
	dilution 5	*	*	*		*	*	*
2D	dilution 3	144	174	108		352	273	372
	dilution 4	31	16	33		20	1	11
	dilution 5	3	1	3		1	4	3

*plates were cracked because they were frozen

 

Next Steps:

• Redo interlab CFU protocol
• Let overnight cultures settle on bench (LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG) and (LB+KAN+MG1655ΔlacI+pET28a+arg1)
• Centrifuge pET28a+arg1 overnight cultures at 350g for 4 hours (LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG) and (LB+KAN+MG1655ΔlacI+pET28a+arg1)
• Streak out a single colony from the MG1655ΔlacI+pET28a+arg1 plate on an LB+KAN plate

 

Day 2, Tuesday 19/06

People In Lab: Amalia, Daniel, Nina, Tashi

 

Agenda:

• Continue interlab CFU protocol (up until plating)
• Centrifuge 1 overnight culture (LB+KAN+MG1655ΔlacI+IPTG) and 1 overnight culture (LB+KAN+MG1655ΔlacI) for 4 hours at 350g
• Keep 1 overnight culture (LB+KAN+MG1655ΔlacI+IPTG) and 1 overnight culture (LB+KAN+MG1655ΔlacI) on bench and observe
• Re-streak MG1655ΔlacI+pET28a+arg1 transformation on LB+KAN to get single colonies (was not incubated yesterday)
• Make new overnight culture of MG1655ΔlacI+pET28a+arg1

 

Equipment used:

• Bunsen burner
• Plate reader
• Shaker in autoclave room
• Centrifuge in room 301
• 37°C incubator in room 301

 

Protocol: Interlab protocol used for CFU experiement

 

Overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1

-5mL LB+25μL KAN+incoulation from a blob from the LB+KAN+MG1655ΔlacI+pET28a+arg1 transformation plate

-tube placed in shaker at 37°C at 220rpm

 

Observations:

pET28a+arg1 induction

LB+KAN+MG1655ΔlacI+pET28a+arg1, LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG in centrifuge - cells pelleted at the bottom

-potential reason - too many gs

LB+KAN+MG1655ΔlacI+pET28a+arg1, LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG on bench - no separation

-potential reasons -arg1 not induced by IPTG?

-too hard flotation to see because there is no reporter

 

Centrifuged LB+KAN+MG1655ΔlacI+pET28a+arg1+IPTG (left )and LB+KAN+MG1655ΔlacI+pET28a+arg1 (right)

 

Next Steps:

• LB media
• LB+KAN plates
• Dilute overnight culture to OD=0.3
• Make IPTG dilution
• Induce LB+KAN+MG1655ΔlacI+pET28a+arg1 culture with 3μM IPTG for 22 hours (2 tubes)
• Make new LB+KAN+MG1655ΔlacI+pET28a+arg1 overnight culture for 22 hours (2 tubes)
• Count colonies for interlab CFU
• Streak out a single colony from the (MG1655ΔlacI) plate on an LB+KAN plate
• Make protocol for growth curve for dry lab

 

Day 3, Wednesday 20/06

People In Lab: Amalia, Daniel, Jasmeen, Nina, Tashi

 

Agenda:

• Make LB liquid media
• Make LB+KAN plates
• Count colonies for interlab CFU
• Streak out a single colony from the MG1655ΔlacI+pET28a+arg1 plate on an LB+KAN plate
• Induce LB+KAN+MG1655ΔlacI+pET28a+arg1 culture with 3μM IPTG for 22 hours (2 tubes)
• Make new LB+KAN+MG1655ΔlacI+pET28a+arg1 overnight culture for 22 hours (2 tubes)

 

Equipment used:

• Autoclave
• Bunsen burner
• Shaker in autoclave room
• 37°C incubator in room 301
• Spectrophotomter

 

Protocol: iGEM protocols used for LB+agar, interlab protocol used for CFU experiement

 

IPTG dilution #1 in LB

C₁V₁ = C₂V₂

C₁ = 1M

C₂ = 3mM

V₂ = 10mL

V₁ = 30μL

= take 30ul of stock and add to 10mL LB+KAN

 

IPTG dilution #2 in LB

C₁V₁ = C₂V₂

C₁ = 3mM

C₂ = 3uM

V₂ = 25mL

V₁ = 25μL

= take 25ul of dilution #1 and add to LB+KAN

 

pET28a+arg1 overnight culture

1:8 dilution, measure OD, OD = 0.25

0.25x8 = 2

C₁V₁ = C₂V₂

C₁ = 2

C₂ = 0.3

V₂ = 25mL

V₁ = 3.75mL

 

Total volume = 25mL

 

25mL - 3.75mL = 21.25mL

-21.25mL LB + KAN + 3.75mL overnight culture

-21.25mL LB + KAN + IPTG + 3.75mL overnight culture

 

Abs₆₀₀ blank (LB+KAN+IPTG) = 0.00 (tared)

Abs₆₀₀ (LB+KAN+IPTG+ARG1) = 0.127

 

Both tubes placed in shaker at 37°C at 220 rpm (one with IPTG and one without)

 

Observations:

CFU colony count #2

		Colony 1				Colony 2
2B	dilution 3	180	138	40		77	78	91
	dilution 4	6	16	8		10	8	4
	dilution 5	2	3	2		1	0	1
2D	dilution 3	215	150	149		83	115	274
	dilution 4	45	28	28		30	14	28
	dilution 5	2	2	2		0	4	4

 

Colony forming unit calculation (using Dilution 3 data)

Calculated for Interlab Form IV

(# of colonies) x (Final Dilution Factor) = CFU/mL

Final Dilution Factor = 8 x 10⁴

 

	Colony 1	Colony 2	-		Colony 1	Colony 2
2B	8.64 x 10^6	6.16 x 10^6	-	2D	1.72 x 10^7	6.64 x 10^6
	1.104 x 10^7	6.24 x 10^6	-		1.2 x 10^7	9.20 x 10^6
	3.20 x10^6	7.28 x 10^6	-		1.192 x 10^7	2.192 x 10^7

MG1655ΔlacI+pET28a+arg1 streak to get single colonies

 

Next Steps:

• LB+KAN plates
• Make KAN dilutions
• Order primers
• Order blue protein

 

Day 4, Thursday 21/06

People In Lab: Amalia, Daniel, Jasmeen, Nina

 

Agenda:

• Make LB + KAN plates
• Make KAN dilutions
• Make overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1 for dry lab growth curve
• Order primers for pET28a+arg1
• Order blue protein

 

Equipment used:

• Bunsen burner
• Shaker in room 315

 

Protocol:

KAN dilutions

(800μL of nuclease-free water+200μL 50mg/mL KAN = 1mL 10mg/mL KAN) x3

 

Overnight culture of LB+KAN+MG1655ΔlacI+pET28a+arg1 for growth curve

-(15mL LB + 75μL KAN + incoulation from colony on newest MG1655ΔlacI+pET28a+arg1 plate) x3

-tube placed in shaker at 37°C at 220rpm

 

Observations:

MG1655ΔlacI+pET28a+arg1 streak to get clonal colonies

 

Next Steps:

• LB+KAN plates
• Make KAN dilutions
• Do digest and run gel
• Dry lab growth curve
• Order amilCP

 

Day 5, Friday 22/06

People In Lab: Amalia, Nina, Daniel, Tashi

 

Agenda:

• Make LB + KAN plates
• Make KAN dilutions
• LB+KAN+MG1655ΔlacI+pET28a+arg1 growth curve
• Order amilCP

 

Equipment used:

• Bunsen burner
• Shaker in autoclave room
• Plate reader
• Autoclave

 

Protocol: iGEM protocols for LB+agar and KAN dilutions

 

KAN dilutions

-80mL of 10mg/mL were made

-50 microcentrifuge tubes were filled with 1mL each and 30mL remains in a falcon tube in the fridge

 

LB+KAN+MG1655ΔlacI+pET28a+arg1 growth curve

-1:8 dilution made from each overnight culture (175mL LB+KAN and 25mL culture in well)

-200μl LB+KAN pipetted in well (blank)

-measure OD₆₀₀

-subtract blank value, multiply by 8 to get original concentration (OD)

-dilute each overnight culture to get an OD of 0.1

-take OD again (0h timepoint)

-place the three replicates back in the shaker and measure again every hour (200μL)

 

Observations:

Volumes for LB+KAN+MG1655ΔlacI+pET28a+arg1 in growth curve cultures based on OD values of 1:8 dilutions-blank value multiplied by 8

Overnight culture 1 1:8 dilution OD without blank = 0.2209

Overnight culture 1 original OD = 1.3576

Replicate 1 LB+KAN = 23.158mL

Replicate 1 overnight culture = 1.841mL

 

Overnight culture 2 1:8 dilution OD without blank = 0.2167

Overnight culture 2 original OD = 1.324

Replicate 2 LB+KAN = 23.111mL

Replicate 2 overnight culture = 1.888mL

 

Overnight culture 3 1:8 dilution OD without blank = 0.2235

Overnight culture 3 original OD = 1.3784

Replicate 3 LB+KAN = 23.186mL

Replicate 3 overnight culture = 1.814mL

 

LB+KAN+MG1655ΔlacI+pET28a+arg1 in growth curve data

0	0.094	0.0942	0.1022	*0.0512
1	0.1808	0.1757	0.1713
2	0.255	0.2538	*0.4448
3	0.3391	0.3247	0.3332
4	0.3937	0.4075	0.4032
5	0.4539	0.4688	0.4326
6	0.4652	0.4797	0.4705

*Replicate 3 OD at 2h has an incorrect measurement. All 2h replicates were retested an hour later and they all had very similar values.

*All measurements shown already have the blank value subtracted from the raw value

 

Next Steps:

• PCR pET28a+arg1 with new primers
• Give Scott LB plate to streak with BL21
• LB+AMP plates (for gibson positive control)
• Order gibson
• Order amilCP

 

 

 

 

Day 1, Monday 25/06

People In Lab: Daniel, Nina, Tashi

 

Agenda:

•      Make LB+AMP plates
•      Autocleave tips (p200)
•      Run practice PCR with pSB1C3
•      pSB1C3_UNS3_REV Primer
•      pSB1C3_UNS2_FWD Primer

 

Equipment used:

•      Autoclave
•      Thermocycler
•      Bunsen Burner

 

Protocol:

6 x 50μL reactions for amplifying pSB1C3

-Primers 2.5 ul * 6 = 15 ul * 2 (rev&fwd)

5x buffer (HF or GC) of Phusion ---> 10ul * 6 = 60ul

10mM of dNTPs ---> 1ul * 6 = 6ul

DMSO(100%) ---> 6*50*3% = 9ul

Phusion polymerase ---> 0.5*6 = 3ul

Nuclease free water ----> 300ul - (60ul + 9ul + 3ul + 30 ul + 0.07ul) = 197.93 ul (forgot to add 6ul dNTPs, solution more dilute)

pSB1c3 (142ng/ul)-----> 0.07ul (0.1ul used)

UNS3 _rev : CGACCTTGATGTTTCCAGTCCGATTGAGGACCTTCAGTGCCTCTAGAAGCGGCCGCG

uns2_FWD: GCTGGGAGTTCGTAGACGGAAACAAACGCAGAATCCAAGCTACTAGTAGCGGCCGCT

NEB temp: 72°C

 

 

LB+AMP plates:

Accoding to the protocol found in iGEM binder.

C₁= 50mg/μL

C₂=50ug/mL

V₂=500mL

V₁=0.5mL

 

Next steps:

•      Run practice PCR with protocol on thermocycler
•      Run gel for PCR product
•      Overnight culture for growth curve
•      Innoculation for growth curve (3x50mL falcon tubes)

 

Day 2, Tuesday 26/06

People In Lab: Amalia, Daniel, Nina, Jasmeen, Tashi

 

Agenda:

•      Run practice PCR with protocol on thermocycler
•      Run gel for PCR product
•      Overnight culture for growth curve
•      Innoculation for growth curve (3x50ml falcon tubes)

 

Equipment used:

•      Thermalcycler
•      Shaker
•      Electrophoresis machine
•      UV light for gel visualization

 

Protocol:

Used protocols from iGEM binder for casting and loading gel for gel electrophoresis. Used protocol from Phusion for PCR reaction.

 

Growth Curve

-add 25mL LB+KAN to 3 50mL falcon tubes

-run blank readings

-innoculate 3 tubes with clonal ARG1 plasmid in MG1655deltalacI and take OD readings every 30 mins for 10 hours

 

PCR mastermix

FWD PSB1C3 UNS2 505.7 ng/ul (nanodrop)

REV PSB1C3 UNS 3 894.1 ng/ul (nanodrop)

 

4 x 50ul reactions

-5x buffer 10ul x 4 = 40ul

-10mM dNTPs 1ul x 4 = 3ul (wrong)

-DMSO 1.5ul x 4 = 6ul

-phusion polymerase 0.5ul x 4 = 2ul

-RFP plasmid (142 ng/ul)

-dilute to 1ng/ul

-141ul UP water + 1ul RFP plasmid

-10ng x 4 = 10ul x 4 = 40ul

-FWD primer

-dilute to 1ng/ul

-504.7 UP water + 1ul primer

-2.5ul x 4 = 10ul

-REV primer

-dilute to 1ng/ul

-893.1 UP water + 1ul primer

-2.5ul x 4 = 10ul

-UP water 50ul x 4 - (40ul + 3ul + 6ul + 2ul + 40ul + 10ul + 10ul) = 89ul

-add 50ul of mastermix to 3 PCR tubes

 

Thermocycler settings

Hot start: 98 degrees

 

Denaturing: 98 degrees - 30s

 

Annealing: 98 degrees - 10s

72 degrees - 30s

72 degrees - 90s

 

Extension: 72 degrees - 10min

 

Hold: 4 degrees

 

 

Gel electrophoresis:

-nanodrop of product concentrations

 

PCR 1	600.2 ng/ul
PCR 2	341 ng/ul
PCR 3	398 ng/ul
PCR 4	403.4 ng/ul
PCR 5	313 ng/ul
PCR 1.1	269 ng/ul
PCR 1.2	280 ng/ul
PCR 1.3	323 ng/ul

PCR 1-5 = PCR products from 06/25/18

PCR 1.1-1.3 = PCR products from 06/26/18

 

-make dilutions usch that each PCR product has a concentration of 10ng/ul

-take 1ul of product and dilute in UP water

-eg. 1ul PCR 1 + 59ul UP water

-take 10ul of dilution and mix with 2ul loading dye

-load 12ul into wells

-V = 100

-A = 3.00 max

-W = 300 max

 

 

Observations:

 

DNA wells in gel

DNA ladder (0.1-10kb)

PCR 1

PCR 2

PCR 3

PCR 4

PCR 5

PCR 1.1

PCR 1.2

PCR 1.3

Next steps:

•      Finish dry lab growth curve for MG1655deltalacI in LB+KAN

 

  

Day 3, Wednesday 27/06

People In Lab: Amalia, Jasmeen, Nina, Tashi

 

Agenda:

• Finish dry lab growth curve for MG1655deltalacI in LB+KAN
• Run PCR with undiluted DNA
• Autoclave beakers and jars
• Streak out BL21 on an LB plate

 

Equipment used:

• Autoclave
• Electrophoresis machine
• Gel doc in room 319
• Bunsen burner

 

Protocol:

Used protocols from iGEM binder for casting and loading gel for gel electrophoresis.

 

Gel electrophoresis:

-load wells

-V = 100

-A = 3.00 max

-W = 300 max

 

Observations:

Dry lab growth curve for MG1655deltalacI in LB+KAN data

Blank	0.0465	0.0469	0.0475
0	0.0009	0	0.0012
0.5	0.0006	0.0002	-0.0006
1	0.0004	0.007	0
1.5	0.0015	-0.0017	-0.002
2	0.0008	0.005	0.0006
2.5	0.0026	-0.0024	0.0021
3	0.0125	0.0112	0.0073
3.5	0.0052	0.0099	0.0135
4	0.0182	0.0218	0.0301
4.5	0.0026	0.0475	0.0569
5	0.0675	0.1095	0.1241
5.5	0.105	0.1352	0.1496
6	0.1894	0.2295	0.2437
6.5	0.2181	0.2469	0.2506
7	0.2452	0.2818	0.2734
7.5	0.2649	0.3103	0.2781
8*	0.3018	0.3585	0.3656
8.5	0.3376	0.364	0.3548
9	0.358	0.3953	0.3864
9.5	0.3888	0.4057	0.404
10	0.4101	0.4305	0.4261
10.5	0.4494	0.4483	0.4571
11.5	0.468	0.4638	0.4764
23	0.8631	0.9021	0.963

*this measurement was taken after being out of the shaker for 30 mins

All measurements shown already have the blank value subtracted from the raw value

 

Gel electrophoresis for PCR

DNA ladder

PCR 1

PCR 2

PCR 3

PCR 4

PCR 5

PCR 1.1

PCR 1.2

PCR 1.3

PCR 1

PCR 1-5 = PCR products from 06/25/18

PCR 1.1-1.3 = PCR products from 06/26/18

Gel from PCR.jpg

Potential reasons for this result:

-PCR did not work

-the annealing temperature was wrong because it was calculated using the whole primer, instead of only the binding sequence

-the primers don't work

-the primers were suspended in water instead of TE buffer and could therefore be degraded

-nanodrop had inaccurate measurement for primer concentrations since they were old and small

-the primers were diluted to a concentration that would make them the limiting reagent for the reaction

 

 

Next steps:

•      Make LB
•      Overnight culture of BL21
•      PCR ARG1 + UNSs
•      Transform ARG1 into BL21

 

  

Day 4, Thursday 28/06

People In Lab: Ahmed, Amalia, Daniel, Jasmeen, Nina, Tashi

 

Agenda:

•      Make LB
•      PCR ARG1 + UNSs
•      Transform ARG1 into BL21
•      RFP digest

 

Equipment used:

•      Autoclave
•      Shaker in autoclave room
•      Benchtop incubator with shaker
•      Bunsen burner
•      Thermocycler
•      Electrophoresis machine
•      Gel doc

 

Protocol:

Used protocols from NEB for PCR and digestion

 

PCR mastermix

6 x 20ul reactions

 

UNS3 FWD

UNS2 REV

 

-5x HF buffer 4ul x 6 = 24ul

-10mM dNTPs 0.4ul x 6 = 2.4ul

-10uM FWD primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM FWD primer

-10uM REV primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 2ul primer + 18ul UP water = 20ul 10uM REV primer

-ARG 1 - dilute to 1ng/ul (original 39.3ng/ul)

-1ul ARG1 + 38.3ul UP water

-1ul x 6 = 6ul

-phusion DNA polymerase 0.2ul x 6 = 1.2ul

-DMSO 0.6ul x 6 = 3.6ul

-UP water 20ul x 6 - (24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul) = 89ul

-add 20ul of mastermix to 5 PCR tubes

 

-annealing temperature = 60 degrees

 

Thermocycler settings

 

Denaturing: 98 degrees - 30s

 

Annealing x30: 98 degrees - 10s

60 degrees - 30s

72 degrees - 363s

 

Extension: 72 degrees - 10min

 

Hold: 4 degrees

 

RFP digest

-1ul SPeI

-1ul EcoRI-HF

-7ul RFP plasmid

-5ul 10x cutsmart

-36ul UP water

 

Observations:

 

Gel for ARG1 PCR

DNA ladder 1kb

1

2

3

4

NTC

Table 5 - concentration of template is too high because the plasmid was not diluted, proper concentrations in gel represented by table 6

 

Gel for ARG 1 PCR with correct concentrations

DNA ladder 1kb

1.1

1.2

1.3

1.4

NTC

Digest

 

Next steps:

•      Run gels with a different ladder
•      Rerun gels with fresh TAE buffer
•      Do a PCR using the thermocycler in room 303 of PSB1C3 + RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)
•      Do a PCR using the thermocycler in room 403 of PSB1C3 + RFP and colony PCR primers
•      Make competent BL21 cells

 

 

Day 5, Friday 29/06

People In Lab: Ahmed, Amalia, Daniel, Nina, Tashi

 

Agenda:

•      Run gels with a different ladder
•      Rerun gels with fresh TAE buffer
•      Do a PCR using the thermocycler in room 303 of pSB1C3+RFP and colony PCR primers using thermo DNA polymerase (temperature gradient)
•      Do a PCR using the thermocycler in room 403 of pSB1C3+RFP and colony PCR primers
•      Make competent BL21 cells
•      Autoclave baffel flasks

 

Equipment used:

•      Thermocycler in 303
•      Thermocycler in 403
•      Electrophoresis machine
•      Gel doc
•      Autoclave

 

Protocol:

 

PCR mastermix

pSB1C3+RFP with pSB1C3 colony primers

6 x 20ul reactions

 

-5x HF buffer 4ul x 6 = 24ul

-10mM dNTPs 0.4ul x 6 = 2.4ul

-10uM FWD primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM FWD primer

-10uM REV primer 1ul x 6 = 6ul

-we have 100uM so we will dilute 10ul primer + 90ul UP water = 100ul 10uM REV primer

-RFP - dilute to 1ng/ul (original 142ng/ul)

-1ul RFP + 141ul UP water

-1ul x 6 = 6ul - 1 (NTC) = 5ul

-phusion DNA polymerase 0.2ul x 6 = 1.2ul

-DMSO 0.6ul x 6 = 3.6ul

 

-total in mastermix without water or template = 24ul + 2.4u + 6ul + 6ul + 6ul + 1.2ul + 3.6ul = 43.2ul = 7.2ul per reaction

-for NTC: 7.2ul mastermix + 12.8ul UP water

-for remaining mastermix: 100ul - (43.2ul - 7.2ul NTC) - 5ul RFP = 59ul UP water

-add 20ul of mastermix to 5 PCR tubes

 

-temperature gradient:

1: 55 degrees

2: 59.3 degrees

3: 61 degrees

4: 65 degrees

NTC: 61 degrees

 

Thermocycler settings

 

Denaturing: 98 degrees - 30s

 

Annealing x30: 98 degrees - 10s

55-60 degrees - 30s

72 degrees - 363s

 

Extension: 72 degrees - 10min

 

Hold: 4 degrees

 

 

Observations:

 

Jun 29th 2018 Thermo Phusion Arg1 UNS2 FWD and UNS3 REV at 60C room 303.jpg

Jun 29th 2018 Thermo Phusion Arg1 (1ng) UNS2 FWD and UNS3 REV and digest at 60C room 303.jpg

 

pSB1C3 temperature gradient colony primers room 303

 

June 29, 2018 pSB1C3 (RFP) THERMO PHUSION 60C 403pcrmachine.jpg

Next steps:

•      Temperature gradient PCR without DMSO
•      Find Susie to do a biowaste disposal and autoclaving
•      Redesign primers for arg1

 

Day 1, Tuesday 03/07

People In Lab: Daniel, Tashi, Jasmeen

 

Agenda:

•      Growth curve for BL21 + Arg1 -> innoculation

 

Protocol:

•      Growth Curve(BL-21 cells + arg1 plasmid)
•      We started from innoculation.
•      For first 2 hours, we took the OD measurement every 30 minutes.
•      The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)
•      After 2 hours, we took the OD measuremetn every 15 minutes.
•      Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)

 

Results:

Growth Curve

 

	OD Measurements ( in triplicate)
Time (h)	1	2	3	log 1	log 2	log 3
0	0.0128	-0.0032	-0.009	-1.89279	/	/
0.5	0.0018	-0.0015	-0.0045	-2.74473	/	/
1	0.0013	-0.0015	-0.0024	-2.88606	/	/
1.5	-0.0002	-0.0013	-0.0075	/	/	/
2	0.0065	0.0004	-0.0073	-2.18709	-3.39794	/
2.25	0.0004	-0.002	-0.0073	-3.39794	/	/
2.5	0.0012	-0.0019	-0.0065	-2.92082	/	/
2.75	0.0007	-0.002	-0.008	-3.1549	/	/
3	0.0013	0.0006	-0.0078	-2.88606	-3.22185	/
3.25	0.0032	0.0052	-0.0069	-2.49485	-2.284	/
3.5	0.0026	0	-0.0061	-2.58503	/	/
3.75	0.0014	0	-0.0073	-2.85387	/	/
4	0.0011	0.0004	-0.0053	-2.95861	-3.39794	/
4.25	0.0056	0.0003	-0.0057	-2.25181	-3.52288	/
4.5	0.0076	0.0001	-0.0061	-2.11919	-4	/
4.75	0.0008	0.0009	-0.0073	-3.09691	-3.04576	/
5	0.0051	-0.0002	-0.0059	-2.29243	/	/
5.25	0.0049	0.0034	-0.0024	-2.3098	-2.46852	/
5.75	0.007	0.0088	0.0043	-2.1549	-2.05552	-2.36653
6.25	0.0156	0.0193	0.0187	-1.80688	-1.71444	-1.72816
6.75	0.0293	0.0403	0.0462	-1.53313	-1.39469	-1.33536
7.25	0.0681	0.0828	0.0946	-1.16685	-1.08197	-1.02411
7.75	0.1115	0.1328	0.1299	-0.95273	-0.8768	-0.88639
8.25	0.1629	0.2011	0.2112	-0.78808	-0.69659	-0.67531

image.png

Plan for future:

Redo growth curve and take OD measurements every 30 minutes.

 

Day 2, Wednesday 04/07

 

Individual Name: Daniel

People In Lab: Daniel, Tashi, Amalia, Jasmeen

 

Agenda:

•      Inoculate BL21+arg1 and BL21 cells
•      IPTG induction
•      Make liquid LB medium

 

Protocol:

•      Floatation Assay:
•      Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction
•      Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)
•      When OD₆₀₀ = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.

 

 

Day 3, Thursday 05/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

 

Agenda:

•      Floatation Assay
•      Pick the overnight induction sample and measure the OD
•      Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3
•      IPTG induction for newly inoculated culture
•      Growth curve with BL21+arg1 cells ( 30mins interval)

 

 

Protocol:

1. Floatation Assay:

• Based on Shapiro Lab protocol
• centrifuge the sample tubes under 350g for 4 hrs
• 3 sample tubes were set on the benchtop

Change plan for the floatation assay:

• starting from 5 ml of overnight culture for 16hrs
• 1:100 dilution of the starting culture and let the OD reaches 0.5
• Add IPTG to make conc. of 0.4mM(maybe 0.8mM for cell line we used) in the cell culture and start the induction for 22hrs under 30^oC.
• After induction, centrifuge under 350g for 4 hrs

2. Growth curve:

• starting from inoculation
• the cell was grown in shaker( 220RPM & 37^oC)
• Take the OD every 30 mins ( add 200ul to the plate reader)

 

Results:

Flotation observation:

 

BL21+arg1 Benchtop.jpg

BL21+IPTG Benchtop.jpg

BL21+arg1+IPTG Benchtop.jpg: Floating tissue observed

BL21+arg1 centrifuged.jpg

BL21 + IPTG Centrifuged.jpg: Floating tissue observed why？

BL21+arg1+IPTG centrifuged.jpg: Floating tissue observed

 

Growth Curve:

 

0-11 hrs

 

image.png

14.5-25 hrs

 

 

image.png

 

 

Day 4, Friday 06/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

 

Agenda:

•      Streak the plate of BL-21 non-transformed cell onto LB only plate
•      Run PCR with Phusion
•      Re-design the Arg1-UNS2&uns3 primers
•      Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve

 

Protocol:

•      PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56⁰C
•      HF buffer 5X 8ul
•      10mM dNTPs 0.8ul
•      10um FWD primer 2ul
•      10um REV primer 2ul
•      1ng/ul Arg1 2ul
•      phusion DNA polyemrase 0.4ul

 

Results:

 

Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg: no band observed

 

 

 

 

 

 

 

 

Day 1, Tuesday 03/07

People In Lab: Daniel, Tashi, Jasmeen

 

Agenda:

•      Growth curve for BL21 + Arg1 -> innoculation

 

Protocol:

•      Growth Curve(BL-21 cells + arg1 plasmid)
•      We started from innoculation.
•      For first 2 hours, we took the OD measurement every 30 minutes.
•      The plate reader was pre-set to 1) shake ( 1 mm amplitude, 7 sec) 2) measure ( 600mm wavelength, 5 flashes)
•      After 2 hours, we took the OD measuremetn every 15 minutes.
•      Since the measurements obtained were seemed to be random flucuation, the time interval for every measurement was switched back to 30mins (after ~5 hours)

 

Results:

Growth Curve

 

	OD Measurements ( in triplicate)
Time (h)	1	2	3	log 1	log 2	log 3
0	0.0128	-0.0032	-0.009	-1.89279	/	/
0.5	0.0018	-0.0015	-0.0045	-2.74473	/	/
1	0.0013	-0.0015	-0.0024	-2.88606	/	/
1.5	-0.0002	-0.0013	-0.0075	/	/	/
2	0.0065	0.0004	-0.0073	-2.18709	-3.39794	/
2.25	0.0004	-0.002	-0.0073	-3.39794	/	/
2.5	0.0012	-0.0019	-0.0065	-2.92082	/	/
2.75	0.0007	-0.002	-0.008	-3.1549	/	/
3	0.0013	0.0006	-0.0078	-2.88606	-3.22185	/
3.25	0.0032	0.0052	-0.0069	-2.49485	-2.284	/
3.5	0.0026	0	-0.0061	-2.58503	/	/
3.75	0.0014	0	-0.0073	-2.85387	/	/
4	0.0011	0.0004	-0.0053	-2.95861	-3.39794	/
4.25	0.0056	0.0003	-0.0057	-2.25181	-3.52288	/
4.5	0.0076	0.0001	-0.0061	-2.11919	-4	/
4.75	0.0008	0.0009	-0.0073	-3.09691	-3.04576	/
5	0.0051	-0.0002	-0.0059	-2.29243	/	/
5.25	0.0049	0.0034	-0.0024	-2.3098	-2.46852	/
5.75	0.007	0.0088	0.0043	-2.1549	-2.05552	-2.36653
6.25	0.0156	0.0193	0.0187	-1.80688	-1.71444	-1.72816
6.75	0.0293	0.0403	0.0462	-1.53313	-1.39469	-1.33536
7.25	0.0681	0.0828	0.0946	-1.16685	-1.08197	-1.02411
7.75	0.1115	0.1328	0.1299	-0.95273	-0.8768	-0.88639
8.25	0.1629	0.2011	0.2112	-0.78808	-0.69659	-0.67531

image.png

Plan for future:

Redo growth curve and take OD measurements every 30 minutes.

 

Day 2, Wednesday 04/07

 

Individual Name: Daniel

People In Lab: Daniel, Tashi, Amalia, Jasmeen

 

Agenda:

•      Inoculate BL21+arg1 and BL21 cells
•      IPTG induction
•      Make liquid LB medium

 

Protocol:

•      Floatation Assay:
•      Inoculate BL21 +arg1 cells and wait the OD reach 0.3 before 22hrs of IPTG induction
•      Total of 6 tubes : 3 tubes ( BL21 + IPTG , BL21 + arg1, BL21 + arg1 + IPTG) * 2 treatments ( stand on tabletop and centrifuge under 350g for 4hrs)
•      When OD₆₀₀ = 0.47 we add 30uL of 3mM IPTG to the sample tube to make conc. reach 3uM in the medium.

 

 

Day 3, Thursday 05/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

 

Agenda:

•      Floatation Assay
•      Pick the overnight induction sample and measure the OD
•      Inoculate new culture (BL21 +arg1 *2, BL21) and measure OD to reach 0.3
•      IPTG induction for newly inoculated culture
•      Growth curve with BL21+arg1 cells ( 30mins interval)

 

 

Protocol:

1. Floatation Assay:

• Based on Shapiro Lab protocol
• centrifuge the sample tubes under 350g for 4 hrs
• 3 sample tubes were set on the benchtop

Change plan for the floatation assay:

• starting from 5 ml of overnight culture for 16hrs
• 1:100 dilution of the starting culture and let the OD reaches 0.5
• Add IPTG to make conc. of 0.4mM(maybe 0.8mM for cell line we used) in the cell culture and start the induction for 22hrs under 30^oC.
• After induction, centrifuge under 350g for 4 hrs

2. Growth curve:

• starting from inoculation
• the cell was grown in shaker( 220RPM & 37^oC)
• Take the OD every 30 mins ( add 200ul to the plate reader)

 

Results:

Flotation observation:

 

BL21+arg1 Benchtop.jpg

BL21+IPTG Benchtop.jpg

BL21+arg1+IPTG Benchtop.jpg: Floating tissue observed

BL21+arg1 centrifuged.jpg

BL21 + IPTG Centrifuged.jpg: Floating tissue observed why？

BL21+arg1+IPTG centrifuged.jpg: Floating tissue observed

 

Growth Curve:

 

0-11 hrs

 

image.png

14.5-25 hrs

 

 

image.png

 

 

Day 4, Friday 06/07

People In Lab: Amalia, Daniel, NIna, Tashi, Jasmeen, Ahmed

 

Agenda:

•      Streak the plate of BL-21 non-transformed cell onto LB only plate
•      Run PCR with Phusion
•      Re-design the Arg1-UNS2&uns3 primers
•      Take reading for 23/24 hrs OD of growth curve tubes in the morining(results was already added to the growth curve

 

Protocol:

•      PCR MasterMix: Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56⁰C
•      HF buffer 5X 8ul
•      10mM dNTPs 0.8ul
•      10um FWD primer 2ul
•      10um REV primer 2ul
•      1ng/ul Arg1 2ul
•      phusion DNA polyemrase 0.4ul

 

Results:

 

Arg1 UNS2 FWD UNS3 REV (temp graident) 58 56C.jpg: no band observed

 

 

 

 

 

 

 

 

Day 1, Monday 16/07

People In Lab: Daniel, Nina, Tashi, Jasmeen

 

Agenda:

• Making AMP stock solution
• Make LB+ AMP plates
• Overnight cultures of BL21 and BL21+ Arg1

 

Running very low on AMP powder

 

Day 2, Tuesday 17/07

People In Lab: Daniel, Nina, Tashi, Jasmeen

 

Agenda:

• PCR of ARG1 plasmid using new IDT primers (UNS3 REV & UNS 2 FWD)
• 1:100 dilution BL21 +ARG 1 in baffle flask, BL21 in baffle flask

 

Protocol:

1. ARG1 new primer gradient PCR [64.5°C-67°C (extra rxn at 66°C)]:

• 7 RXNs 20ul each (One without a template)
• annealing temp: 66⁰C
• Reagent used:
• Q5 Buffer (4μl x 7) 28ul
• 10mM FWD primer (1μ x 7) 7ul
• 10mM REV Primer (1μ x 7) 7ul
• 10mM dNTPs (0.4μl x 7) 2.8ul
• Q5 ploymerase (0.2μl x 7) 1.4ul
• 1μg/μl Template DNA (6μ x 6) 6ul
• Nuc Water Total mix with template for each rxn = 7.6μl
• (20μl each rxn - 7.6μl = 12.5μl ) x 6 = 74.4ul H20 for mastermix
• Total mix without template for each rxn = 6.6μl
• 20μl each rxn - 6.6μl = 13.5μl H2O for NTC

 2. OD readings of BL21+ARG1 and BL21 for induction.

• 1ml was taken out of each culture every hour and placed in a cuvette
• OD was measured using a spectrophotometer

3. Cultures were induced with IPTG at 2:40pm. replicate 1 of BL21+ARG1 was induced with 0.4mM of IPTG. Replicate 2 of BL21+ARG1 was induced with 0.8mM IPTG. BL21 cells were not induced with IPTG.

 

Results

 

1. ARG1 PCR with new primers results

 

37291721_2649158358642891_3010098950041501696_n.jpg

2. OD readings

Time	BL21+ Arg1 rep1	BL21+Arg2 rep2	BL21 rep1
1:16pm	0.086	0.097	0.323
2:30pm	0.353	0.359	1.081

 

Day 3, Wednesday 18/07

People In Lab: Amalia, Nina, Tashi

 

Agenda

• Dpn1 digest of PCR1 product
• PCR purification of PCR1 products
• Nanodrop of PCR1 products after digest and purification
• Overnight culture LB+BL21
• Overnight culture of DH10B Arg1 and pSB1C3
• place tubes in centrifuge 1hr

 

Dpn1 Digest

We have 10ul of PCR product per tube [4 tubes]

• 8ul of PCR product
• 1 ul of Dpn1
• 1 ul of cutsmart (10x)

10 ul of rxn (total)

 

PCR Purification (16,000 g/ 13,000 rpm)

• 30 ul sample
• 2:1 ratio binding buffer sample = 60ul
• Load sample onto column
• spin 1 min and discard flow through
• reinsert column, add 200ul repeat DNA wash buffer
• Transfer column to 1.5ml centrifuge tube
• add 6ul nuclease free water
• wait 1 min, spin 1 min

 

Completed nanodrop of 1ul of PCR purified product

concentration: 100.1 ug/ul

 

Day 4, Thursday 19/07

People In Lab: Amalia, Tashi, Ahmed, Daniel, Jasmeen

Agenda

• PCR on new primers Arg1+UNS2FWD&UNS3REV (anneailing temp 66°C)
• Nanodrop
• Purification of PCR products
• PCR product digest
• Cell competency for BL21
• Gibson assembly (blue protein and Arg1+UNS1&UNS3
• Miniprep: Arg1+cor, RFP + UNS
• Transform gibson into DH5⍺ cell from the kit
• transform RFP from competency cell kit into BL21 cells

 

Protocols

 

PCR Calculation (7 reactions planned) 50 ul

• Master Mix for 8 reactions
• Reagent used:
• Q5 master mix (25μl x 8) 200ul
• 10mM FWD primer (2.5μl x 7) 20ul
• 10mM REV Primer (2.5μl x 7) 20ul
• 1μg/μl Template DNA (2.5μl x 7) 17.5ul
• Nuc Water Total mix with template for each rxn = 17.5μl

20μl for NTC

 

OD readings 1:100 dilution of BL21 for competency

 

 

Time	BL21 rep1	BL21 rep2
12:13pm	0.132	0.133
12.45pm	0.279	0.279
1:08pm	0.459	0.466

Note: Competency protocol was started after the last OD reading

 

Nanodrop ARG1 cor and RFP+UNS

 

 

Plasmid	Conc (ng/ul)
ARG1 cor	64.7
RFP+UNS	85.3

PCR gel for ARG1 and UNS (primers UNS2FWD, UNS3REV)

 

1kb+ NEB ladder

1

2

3

4

5

6

NTC

Gel result

 

image.png

DPN1 digest protocol

• For a 10μl rxn x 2 = 20μl
• 16μl PCR product (well #1 ARG1 with UNS2FWD UNS3 primers)
• 2μl cutsmart buffer
• 2μl DPNI

DNA cleanup

• 2:1 ratio binding buffer :Digest product
• 40μl buffer:20μl digest product
• For elution step use 20μl nuclease free water

Nanodrop ARG1+UNS after cleanup

 

Plasmid	conc(ng/μl)	260/280	260/230
ARG1+UNS	75.4	1.96	1.65

Gibson calculations (note limit for DNA in gibson rxn=0.2 picomoles)

ARG1+UNS

DNA length=12209bp

picomoles we want= 0.0667pmol

DNA Mass we had according to NEB calculator= 503.2ng

503.2ng/75.4ng/μl= 6.67μl --> ARG1+UNS added to gibson rxn

 

Blue protein (K=BBa_K592009)

DNA length= 764bp

picomoles we want= 0.1333333pmol

DNA mass we had according to NEB calculator=62.95ng

 

Note: the blue protein was resuspended in 50μl of nuclease free water for a final concentration of 20ng/μl

 

62.95ng/20ng/μl=3.15μl--> blue protein added to gibson

Transformation of gibson products

Gibson positive control (plated 100μl transformed DH5a (20μl of DH5a cells + 2 μl positive control gibson) onto AMP plate)

Gibson positive control transformation (plated 100μl transormed DH5a (20μl DH5a cells + positive control plasmid) onto AMP plate)

Gibson products (plated 50μl, 100μl, 200μ transformed DH5a (50μl DH5a cells + 2μl of gibson product) onto KAN plates)

Tranformation of RFP plasmid from competency cell kit

plated 100μl of transformed BL21 cells (100μl BL21 cells + 10pg, 50pg, 100pg RFP plasmid) onto CAM plates

 

Day 5, Friday 20/07

People In Lab: Amalia, Tashi, Ahmed, Nina

 

Agenda

• Check Gibson and Bl21 competency plates
• re-transform Gibson positive controls and gibson products

 

Results from Gibson

Both positive control plates (transformation control and gibson control) have colonies

None of the gibson product plates have colonies

 

 

image.png: Gibson plates: top left is positive control for transformation, top right is positive control for gibson, bottom 3 plates are plates with our gibson product transformation. Note the fact that only positive controls have colonies.

Troubleshooting

transformation was repeated

6 KAM plates were plated each with 200μl of transformed DH5a cells (50μl of DH5a cells transformed with 2μl of gibson product)

2 positive control plates: positive control for transformation (20μl of DH5a cells transformed with 2μl positive control plasmid)

positive control for gibson (20μl of DH5a cells transformed with 2μl of positive control gibson)

Results competency plates

plate plated with 50pg of plasmid grew 4 colonies

plate plated with 100pg of plasmid grew 3 colonies

plate plated with 10pg of plasmids did not grow colonies

 

image.png: 10pg

 

image.png: 50pg

 

image.png: 100pg

Note: these photos were taken after 4 days of plating but small colonies were observed after incubation overnight