(Prototype team page) |
|||
Line 1: | Line 1: | ||
− | + | <html lang="en"> | |
− | < | + | <head> |
+ | <title>HebrewU HujiGEM 2018</title> | ||
+ | <meta charset="utf-8"> | ||
+ | <meta name="viewport" content="width=device-width, initial-scale=1"> | ||
+ | <!--- Own CSS ---> | ||
+ | <link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css"> | ||
− | < | + | <!--- Jquery script - ****** remove when uploading to wiki ********** ---> |
− | < | + | <script src="https://ajax.googleapis.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script> |
− | + | ||
− | + | ||
− | </ | + | |
− | < | + | <!--- Main Menu script ---> |
− | < | + | <script type="text/javascript" src="https://2018.igem.org/Template:Hebrewu/Javascript?action=raw&ctype=text/javascript"></script> |
− | + | ||
− | + | ||
− | + | ||
− | </ | + | |
− | < | + | <!--- w3 Css ---> |
− | < | + | <link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/w3?action=raw&ctype=text/css"> |
− | + | ||
+ | <!--- Bootstrap Css ---> | ||
+ | <script src="https://2018.igem.org/Template:HebrewU/boot?action=raw&ctype=text/javascript"></script> | ||
+ | <link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/strap?action=raw&ctype=text/css"> | ||
+ | |||
+ | <style> | ||
+ | /* Disable I-GEM defult properties for blank page */ | ||
+ | #sideMenu, #top_title {display:none;} | ||
+ | #sideMenu, #sideMenu *, #top_menu_inside, #top_menu_inside *{box-sizing: initial; -webkit-box-sizing: initial;} | ||
+ | #content { padding:0px; width:100%; margin-top:-12px; margin-left:0px;} | ||
+ | #body {background-color:#EDEADC; } | ||
+ | #bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent h5 { margin-bottom: 0px; } | ||
+ | |||
+ | .w3-container { | ||
+ | overflow: auto; | ||
+ | } | ||
+ | |||
+ | * { | ||
+ | -webkit-box-sizing:content-box ; | ||
+ | -moz-box-sizing:content-box ; | ||
+ | box-sizing:content-box ; | ||
+ | } | ||
+ | .ahuji { | ||
+ | color:black | ||
+ | } | ||
− | |||
− | |||
− | + | @media (max-width: 1000px) { | |
− | + | .fixed { | |
+ | display: none; | ||
+ | } | ||
− | + | .ulogo { display:none; } | |
− | + | } | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | #panel, #flip_experts #panel_industry { | |
− | + | padding: 5px; | |
+ | text-align: center; | ||
+ | } | ||
+ | #panel panel_industry{ | ||
+ | padding: 50px; | ||
+ | display: none; | ||
+ | } | ||
+ | body { | ||
+ | background-color:blue-gray; | ||
+ | |||
+ | } | ||
+ | </style> | ||
− | < | + | <script> |
− | + | function myFunction() { | |
− | + | var x = document.getElementById("Industry_display"); | |
− | + | if (x.className.indexOf("w3-show") == -1) { | |
+ | x.className += " w3-show"; | ||
+ | } else { | ||
+ | x.className = x.className.replace(" w3-show", ""); | ||
+ | } | ||
+ | } | ||
+ | </script> | ||
− | < | + | <script> |
− | + | function myFunction_2() { | |
− | + | var x = document.getElementById("Interviews_display"); | |
− | + | if (x.className.indexOf("w3-show") == -1) { | |
− | + | x.className += " w3-show"; | |
− | + | } else { | |
− | + | x.className = x.className.replace(" w3-show", ""); | |
− | </ | + | } |
+ | } | ||
+ | </script> | ||
+ | <body> | ||
+ | <div class="w3-blue-gray"> | ||
+ | <ul id="ddmenu_hebrewu"> | ||
+ | <li style="float:left;margin-top:12px;padding-left:15px;"><br />Hebrew</li> | ||
− | <div class=" | + | <div class="huji_homebutton"> |
+ | |||
+ | <a href="javascript:void(0);" class="icon" onClick="show_small_nav()"> | ||
+ | <img src="https://static.igem.org/mediawiki/2018/d/dc/T--Hebrewu--huji_small_manu.png" width="20" height="20" padding:"2px"> | ||
+ | </a> | ||
+ | |||
+ | <a href="https://2018.igem.org/Team:HebrewU"> | ||
+ | <img class="ulogo" src="https://static.igem.org/mediawiki/2018/d/d3/T--Hebrewu--huji_boiling_logo.png" width="60" height="60" style="margin-left:-27px;"> | ||
+ | </a> | ||
+ | </div> | ||
+ | |||
+ | <li><a>Project</a> | ||
+ | <ul> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Results">Results</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Software">Moolti</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li><a>Lab</a> | ||
+ | <ul> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Design">Yeast Design</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Plant">Plant Design</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Notebook">Notebook</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/InterLab">Inter-lab</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Safety">Safety</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Protocols">Protocols</a></li> | ||
+ | </ul> | ||
+ | |||
+ | </li> | ||
+ | |||
+ | |||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Human_Practices">Human Practices</a> | ||
+ | <ul> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Ethics">Ethics</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Global_aspects">Global Aspects</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Public_engagment">Public Engagment</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Open_Source">Open Source</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | <li><a>Team</a> | ||
+ | <ul> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Team">Members</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Attributions">Attributions</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Collaborations">Collaborations</a></li> | ||
+ | <li><a href="https://2018.igem.org/Team:HebrewU/Photo_Gallery">Photo Gallery</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li ><a href="https://2018.igem.org/Team:HebrewU/Judging">Judging</a></li> | ||
+ | |||
+ | <div class="social_huji"> | ||
+ | <a href="https://twitter.com/GemHuji"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/3/39/T--Hebrewu--twitter_logo.png" width="25" height="25"></a> | ||
+ | <a href="https://www.facebook.com/HUJiGEM"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/8/8a/T--Hebrewu--facebook_logo.png" width="25" height="25"></a> | ||
+ | <a href="https://www.instagram.com/hujigem/"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/5/54/T--Hebrewu--insta_logo.png" width="25" height="25"></a> | ||
+ | <a href="https://www.igem.org/Main_Page"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/1/1a/T--Hebrewu--IGEM_logo.png" width="30"></a> | ||
+ | </div> | ||
+ | </ul> | ||
− | <div class=" | + | <!----------- Responsive Navbar ---------------> |
+ | <div class="huji_smallnav" id="huji_shownav"> | ||
+ | <button class="huji_small_navbar">Project</button> | ||
+ | <div class="huji_small_navbar_panel"> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Results"><button class="b_huji_small_subnav">Results</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav">Moolti</button></a> | ||
+ | </div> | ||
− | < | + | <button class="huji_small_navbar">Lab</button> |
− | < | + | <div class="huji_small_navbar_panel"> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/Design"><button class="b_huji_small_subnav">Yeast Design</button></a> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/Plant"><button class="b_huji_small_subnav">Plant Design</button></a> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/Notebook"><button class="b_huji_small_subnav">Notebook</button></a> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/InterLab"><button class="b_huji_small_subnav">InterLab</button></a> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/Safety"><button class="b_huji_small_subnav">Safety</button></a> |
− | < | + | <a href="https://2018.igem.org/Team:HebrewU/Protocols"><button class="b_huji_small_subnav">Protocols</button></a> |
− | < | + | |
− | < | + | |
− | </ | + | |
− | + | </div> | |
− | + | ||
+ | <button class="huji_small_navbar">Human Practice</button> | ||
+ | <div class="huji_small_navbar_panel"> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Human_Practices"><button class="b_huji_small_subnav">Human Practice - Main Page</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Ethics"><button class="b_huji_small_subnav">Ethics</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Global_aspects"><button class="b_huji_small_subnav">Global Aspects</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Public_Engagment"><button class="b_huji_small_subnav">Public Engagment</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Open_Source"><button class="b_huji_small_subnav">Open Source</button></a> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | <button class="huji_small_navbar">Team</button> | ||
+ | <div class="huji_small_navbar_panel"> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Members"><button class="b_huji_small_subnav">Members</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Attributions"><button class="b_huji_small_subnav">Attributions</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Collaborations"><button class="b_huji_small_subnav">Collaborations</button></a> | ||
+ | <a href="https://2018.igem.org/Team:HebrewU/Photo_Gallery"><button class="b_huji_small_subnav">Photo Gallery</button></a> | ||
+ | </div> | ||
+ | |||
+ | <a href="https://2018.igem.org/Team:HebrewU/Judging"><button class="huji_small_navbar">Judging</button></a> | ||
</div> | </div> | ||
+ | <!----------- Script 1 for small navbar ---------------> | ||
+ | <script> | ||
+ | function show_small_nav() { | ||
+ | var x = document.getElementById("huji_shownav"); | ||
+ | if (x.style.display === "none") { | ||
+ | x.style.display = "block"; | ||
+ | } else { | ||
+ | x.style.display = "none"; | ||
+ | } | ||
+ | } | ||
+ | </script> | ||
+ | <!------------ Script 2 for small navbar -------------> | ||
+ | <script> | ||
+ | var acc = document.getElementsByClassName("huji_small_navbar"); | ||
+ | var i; | ||
+ | |||
+ | for (i = 0; i < acc.length; i++) { | ||
+ | acc[i].addEventListener("click", function() { | ||
+ | this.classList.toggle("active"); | ||
+ | var huji_small_navbar_panel = this.nextElementSibling; | ||
+ | if (huji_small_navbar_panel.style.display === "block") { | ||
+ | huji_small_navbar_panel.style.display = "none"; | ||
+ | } else { | ||
+ | huji_small_navbar_panel.style.display = "block"; | ||
+ | } | ||
+ | }); | ||
+ | } | ||
+ | </script> | ||
+ | <!------------ HP start -------------> | ||
− | < | + | <br /> <br /> |
− | + | ||
− | + | ||
− | < | + | <!-- Header --> |
− | < | + | <header class="w3-container w3-center" style="padding-bottom:60px"> |
+ | <h1 class="w3-margin w3-jumbo">Parts</h1> | ||
− | < | + | <a href="#Gal_main_toggle"><button class="w3-button w3-black w3-padding-large w3-large w3-margin-top">Gal 1/10</button> </a> |
+ | <a href="#Gibson_main_toggle"><button class="w3-button w3-black w3-padding-large w3-large w3-margin-top">Gibson brick</button></a> <br /> <br /> | ||
+ | |||
+ | |||
+ | <!-- Gal 1/10 Grid --> | ||
+ | <div id="Gal_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content"> | ||
+ | <h1 class="w3-center">Gal 1/10</h1> <br /> | ||
+ | <h5 class="w3-justify" style="padding-right:30px;padding-left:30px;font-size:130%"> | ||
+ | GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. | ||
+ | Each complimentary strand promotes translation in opposing directions. | ||
+ | Galactose induces transcription, while Glucose serves as a repressor. | ||
+ | The promoter is inducible by as low as 2% Galactose in medium. <br /><br /><br /> | ||
+ | |||
+ | <div class="w3-center"> | ||
+ | <img src="https://static.igem.org/mediawiki/parts/3/33/T--HebrewU--GalBrickMap.png" width="60%"> | ||
+ | </div> <br /><br /><br /> | ||
+ | |||
+ | It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits, | ||
+ | or can simply be used to effectively cut the amount of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.<br /> | ||
+ | |||
+ | To validate this part we preformed Real-Time PCR on yeast with our Leu-44a vector, | ||
+ | containing two subunits of the same protein- 44a-Dioxygenase (44a) . | ||
+ | This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS). | ||
+ | We used Leu2 as a regulating gene, as it is found on the same plasmid, | ||
+ | but it transcription is not dependent on the Gal 1/10 Promoter.<br /><br /> | ||
+ | |||
+ | We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br /> | ||
+ | <ul> | ||
+ | <li >1. 44a- Containing the vector showed in the map above, | ||
+ | with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.</li><br/> | ||
+ | <li> 2. CTRL strain, containing a similar but "empty" vector. | ||
+ | This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted. </li><br/> | ||
+ | </ul> | ||
+ | </h5> | ||
+ | <div class="w3-center"> | ||
+ | <img src="https://static.igem.org/mediawiki/parts/e/ed/T--HebrewU--GalBrickGraph.png" width="80%"> | ||
+ | </div><br/> | ||
+ | |||
+ | <h5 class="w3-justify" style="padding-right:30px;padding-left:30px;font-size:130%"> | ||
+ | After growth, be split each strain into 2 treatments:<br /><br /> | ||
+ | <ul> | ||
+ | <li> 1. Induced: SG media, containing 2% galactose in the media </li> <br/> | ||
+ | <li>2. Uninduced: SD media, containing 2% glucose in the media </li> <br/> | ||
+ | </ul> | ||
+ | |||
+ | As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments. | ||
+ | |||
+ | The results of this experiment are detailed in the graph below. | ||
+ | After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented. | ||
+ | <br /> | ||
+ | <br /> | ||
+ | In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment. <br/> | ||
+ | Additionally, we see approximately equal expression between the uninduced treatment and the control group, | ||
+ | indicating the minor levels could be background noise caused by non-specificity of primers, or primer dimer amplification. | ||
+ | (We used SYBR, and not a probe, therefor the possibility of such background noise arises) | ||
+ | </h5> | ||
+ | </div> | ||
− | </ | + | <!-- Gibson brick Grid --> |
− | < | + | <div id="Gibson_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content"> |
− | < | + | <h1 class="w3-center">Gibson brick</h1> <br /> |
− | </ | + | <h5 class="w3-justify" style="padding-right:30px;padding-left:30px;font-size:130%"> |
+ | An obstacle many team face is finding a way to assemble multiple genetic components into a single | ||
+ | plasmid effectively and quickly. Though the biobrick standard addresses this issue, | ||
+ | we found that using newer, more advanced methods of can help save time and resources. | ||
+ | We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction | ||
+ | is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful. | ||
+ | Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning in to a single vector. | ||
+ | This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment. | ||
+ | Each of our oligos are approximately 40 Bp long, consisting of two components: | ||
+ | <ul> | ||
+ | <li> | ||
+ | 1. Biobrick prefix / suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library. | ||
+ | </li> | ||
+ | <li> | ||
+ | 2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly. | ||
+ | </li> | ||
+ | </ul> | ||
+ | This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction | ||
+ | stitch them all together into a plasmid, ready for transformation. | ||
+ | <br /><br /><br /> | ||
+ | |||
+ | <div class="w3-center"> | ||
+ | <img src="https://static.igem.org/mediawiki/2018/6/64/T--HebrewU--GibsonBricksmall.png" width="60%"> | ||
+ | </div> <br /><br /><br /> | ||
+ | |||
+ | Parts in Registry: <br /> <br /> | ||
+ | |||
+ | <table class="w3-table w3-striped w3-white"> | ||
+ | <tr> | ||
+ | <th> | ||
+ | <p><strong>BioBrick</strong></p> | ||
+ | </th> | ||
+ | <th> | ||
+ | <p><strong>Name</strong></p> | ||
+ | </th> | ||
+ | <th> | ||
+ | <p><strong>Sequence</strong></p> | ||
+ | </th> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667002</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 1 Fw</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667003</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 1 Rv</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667004</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 2 Fw</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667005</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 2 Rv</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667006</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 3 Fw</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667007</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 3 Rv</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667008</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 4 Fw</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td> | ||
+ | <p>BBa_K2667009</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>GibsonBrick 4 Rv</p> | ||
+ | </td> | ||
+ | <td> | ||
+ | <p>TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | |||
+ | <br /> <br /> | ||
+ | |||
+ | Fragments should be amplified in the following order: <br /><br /> | ||
+ | <ul> | ||
+ | <li>Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv. </li> <br/> | ||
+ | <li>Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv. </li> <br/> | ||
+ | <li>Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv. </li> <br/> | ||
+ | <li>Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv. </li> <br/> | ||
+ | <li>Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2. </li><br/><br/> | ||
+ | </ul> | ||
+ | |||
+ | The Custom vector primers should contain the Prefix and Suffix respectively, along with <br/> | ||
+ | homologous regions that will allow for assembly with the Vector your team is using. <br/> | ||
+ | |||
+ | </div> | ||
+ | </body> | ||
</html> | </html> |
Revision as of 11:20, 12 October 2018
Parts
Gal 1/10
GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously.
Each complimentary strand promotes translation in opposing directions.
Galactose induces transcription, while Glucose serves as a repressor.
The promoter is inducible by as low as 2% Galactose in medium.
It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits,
or can simply be used to effectively cut the amount of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.
To validate this part we preformed Real-Time PCR on yeast with our Leu-44a vector,
containing two subunits of the same protein- 44a-Dioxygenase (44a) .
This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS).
We used Leu2 as a regulating gene, as it is found on the same plasmid,
but it transcription is not dependent on the Gal 1/10 Promoter.
We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:
- 1. 44a- Containing the vector showed in the map above,
with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.
- 2. CTRL strain, containing a similar but "empty" vector.
This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.
After growth, be split each strain into 2 treatments:
- 1. Induced: SG media, containing 2% galactose in the media
- 2. Uninduced: SD media, containing 2% glucose in the media
As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments.
The results of this experiment are detailed in the graph below.
After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented.
In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.
Additionally, we see approximately equal expression between the uninduced treatment and the control group,
indicating the minor levels could be background noise caused by non-specificity of primers, or primer dimer amplification.
(We used SYBR, and not a probe, therefor the possibility of such background noise arises)
Gibson brick
An obstacle many team face is finding a way to assemble multiple genetic components into a single
plasmid effectively and quickly. Though the biobrick standard addresses this issue,
we found that using newer, more advanced methods of can help save time and resources.
We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction
is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful.
Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning in to a single vector.
This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment.
Each of our oligos are approximately 40 Bp long, consisting of two components:
-
1. Biobrick prefix / suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
-
2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly.
This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction
stitch them all together into a plasmid, ready for transformation.
Parts in Registry:
BioBrick |
Name |
Sequence |
---|---|---|
BBa_K2667002 |
GibsonBrick 1 Fw |
GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG |
BBa_K2667003 |
GibsonBrick 1 Rv |
TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC |
BBa_K2667004 |
GibsonBrick 2 Fw |
CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG |
BBa_K2667005 |
GibsonBrick 2 Rv |
TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG |
BBa_K2667006 |
GibsonBrick 3 Fw |
CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG |
BBa_K2667007 |
GibsonBrick 3 Rv |
TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG |
BBa_K2667008 |
GibsonBrick 4 Fw |
TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG |
BBa_K2667009 |
GibsonBrick 4 Rv |
TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG |
Fragments should be amplified in the following order:
- Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv.
- Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv.
- Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv.
- Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv.
- Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.
homologous regions that will allow for assembly with the Vector your team is using.