Difference between revisions of "Team:HSHL/Design"

m
m
 
(26 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
{{HSHL}}
 
{{HSHL}}
 
<html>
 
<html>
 +
 +
<head>
 
<link rel="stylesheet" href="https://use.fontawesome.com/releases/v5.2.0/css/all.css" integrity="sha384-hWVjflwFxL6sNzntih27bfxkr27PmbbK/iSvJ+a4+0owXq79v+lsFkW54bOGbiDQ" crossorigin="anonymous">
 
<link rel="stylesheet" href="https://use.fontawesome.com/releases/v5.2.0/css/all.css" integrity="sha384-hWVjflwFxL6sNzntih27bfxkr27PmbbK/iSvJ+a4+0owXq79v+lsFkW54bOGbiDQ" crossorigin="anonymous">
 +
</head>
 +
  
  
−
<div class="column third_size">
 
 
<a name="top"></a>
 
<a name="top"></a>
 +
<div class="column full_size">
 
<h1>Design</h1>
 
<h1>Design</h1>
−
<p> The HMA3 Sequence is with 2619 bp quite big which make it a little bit difficult for us to actually isolate this sequence out of the <i>A. halleri</i>. That is the reason why we decided to get it synthesized by IDT.
+
</div>
 +
 
 +
<div class="column two_thirds_size">
 +
<h3>1st idea <br>- Working with the whole sequence</h3>
 +
<p> The HMA3 Sequence is with 2619 bp quite big which make it a little bit difficult for us to actually isolate this sequence out of the <i>A. halleri</i>. That is the reason why we decided to get it synthesized by <a href="https://eu.idtdna.com/pages"  target="_blank">IDT</a>.
 
</p>
 
</p>
  
 
<p>First option was to use the whole sequence (2631 bp). A CaMV 35S (universal promoter, <u>Ca</u>uliflower <u>M</u>osaic <u>V</u>irus) is used as a promoter with a length of 345 bp. </p>
 
<p>First option was to use the whole sequence (2631 bp). A CaMV 35S (universal promoter, <u>Ca</u>uliflower <u>M</u>osaic <u>V</u>irus) is used as a promoter with a length of 345 bp. </p>
  
−
<p>For our Biobrick we decided to use the Vector called pSB1C3 with a chloramphenicol resistance. By including the sequence of the restriction sites of EcoRI at the beginning and PstI at the end of our sequence, which are the same restriction sites for the plasmide, we can insert our sequence into our targeted vector. In our specific case EcoRI would cut about two times into our Gene HMA3 for example. To make sure the restriction enzyme will not cut several times into our sequence we had to change some codons in the original sequence of our Gene HMA3 (you can see the changes of the codons below in red). </p>
+
<p>For our Biobrick we decided to use the Vector called pSB1C3 with a chloramphenicol resistance. By including the sequence of the restriction sites of EcoRI at the beginning and PstI at the end of our sequence, which are the same restriction sites for the plasmide, we can insert our sequence into our targeted vector. In our specific case EcoRI would cut about two times into our Gene HMA3 for example. To make sure the restriction enzyme will not cut several times into our sequence we had to change some codons in the original sequence of our Gene HMA3 (you can see the changes of the codons below in red). </p>
 
</div>
 
</div>
  
−
<div class="column two_thirds_size">
+
<div class="column third_size">
−
<img src="https://static.igem.org/mediawiki/2018/c/c9/T--HSHL--design-biobrick.png">
+
    <img src="https://static.igem.org/mediawiki/2018/c/c9/T--HSHL--design-biobrick.png">
 +
    <p></p>
 +
    <a href="https://static.igem.org/mediawiki/2018/c/c9/T--HSHL--design-biobrick.png" target="_blank"><i class="fas fa-external-link-alt"></i></a>
 
</div>
 
</div>
  
Line 23: Line 33:
 
<table>  
 
<table>  
 
   <tr>  
 
   <tr>  
−
       <th> sequence </th>  
+
       <th> Sequence </th>  
−
       <th> length [bp] </th>
+
       <th> Length [bp] </th>
−
       <th> color</th>   
+
       <th> Color</th>   
 
   </tr>  
 
   </tr>  
 
   <tr>  
 
   <tr>  
 
       <td> CaMV 35S promoter</td>  
 
       <td> CaMV 35S promoter</td>  
−
       <td> 245</td>
+
       <td> 345</td>
−
       <td> black</td>  
+
       <td> letters</td>  
 
   </tr>  
 
   </tr>  
 
   <tr>  
 
   <tr>  
 
       <td> AhHMA3 cDNA</td>  
 
       <td> AhHMA3 cDNA</td>  
−
       <td> 2.274</td>
+
       <td> 2274</td>
−
       <td> <span class="highlightGreen">green</span></td>  
+
       <td> <span class="highlightGreen">highlighted</span></td>  
 
   </tr>   
 
   </tr>   
 
   <tr>  
 
   <tr>  
−
       <td> restriction site of EcoRI (G/AATTC)</td>  
+
       <td> Restriction site of EcoRI (G/AATTC)</td>  
 
       <td> 6 </td>
 
       <td> 6 </td>
−
       <td> <span class="highlightYellow">yellow</span></td>  
+
       <td> <span class="highlightYellow">highlighted</span></td>  
 
   </tr>   
 
   </tr>   
 
   <tr>  
 
   <tr>  
 
       <td> restriction site of PstI (CTGCA/G)</td>  
 
       <td> restriction site of PstI (CTGCA/G)</td>  
 
       <td> 6 </td>
 
       <td> 6 </td>
−
       <td> <span class="highlightLightBlue">light blue</span></td>  
+
       <td> <span class="highlightLightBlue">highlighted</span></td>  
 
   </tr>   
 
   </tr>   
 
   <tr>  
 
   <tr>  
 
       <td><b>whole sequence</b> </td>  
 
       <td><b>whole sequence</b> </td>  
−
       <td><b>2.613</b></td>
+
       <td><b>2613</b></td>
 
       <td>  </td>  
 
       <td>  </td>  
 
   </tr>  
 
   </tr>  
Line 60: Line 70:
  
 
<div class="column full_size">
 
<div class="column full_size">
−
<h3>The whole promoter and gene sequence including the restriction sites to ligate into the vector pSB1C3</h3>
+
<h3>Promoter and gene sequence</h3>
−
<p> <span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span> = changed codon to make sure that EcoRI will not cut several times</p>
+
<p> In the following the whole promoter and gene sequence including the restriction sites to ligate into the vector pSB1C3 is shown.
−
<div class="highlight decoration_background">
+
<br><span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span> = changed codon to make sure that EcoRI will not cut several times</p>
−
<p>
+
<img src="https://static.igem.org/mediawiki/2018/1/15/T--HSHL--img_WholeGeneSequence.png">
−
<span class="monospace">
+
 
−
<span class= "highlightYellow">GAATTC</span>TGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCA TCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGC ACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA<span class= "highlightGreen">ATGGCGGAAGGTGAAGAGGCCAAGAAGAAGAATTTACAGACAAGTTACTTCGACGTCGTTGGAATCTGCTGTACATCG GAGGTTTCTATCGTCGGTGACGTTCTCCGTCCACTTGACGGCGTCAAA<span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span>TCCGTTATCGTCCCTTCTAGAACCGTCATCGTTGTCCATGACACTTTCTTGATTTCTCCGCTTCAAATCGTCAAGGCTCTGAATCAAGC AAGACTAGAAGCAAGTGTGAGACCATACGGAGAAACAAGCTTGAAGAGTCAATGGCCAAGTCCTTTTGCAATACTTTCTGGGGTATTTCTTGCTCTCTCCTTCTTCAAATACTTTTATAGTCTGCTTGAATGGCTCGCTGTTG TTGCCGTGGTGGCCGGGATTTTCCCCATCCTTGCTAAAGCTGTTGCTTCGGTCACAAGGTTCAGACTTGATATCAACGCTCTCACTTTTATTGCTGTGATAGCAACACTATGTATGCAGAATTTCACAGAAGCTGCCACAATT GTGTTTCTATTCTCAGTTGCAGATTGGCTAGAGTCTAGTGCTGCTCATAAGGCAAGCACAGTAATGTCATCACTGATGAGCTTAGCGCCACGAAAGGCAGTGATAGCGGAAACTGGACACGAAGTCGATGTAGATGAGGTTAG GATCAACACAATTGTTTCAGTGAAAGCTGGAGAAAGTATACCGATTGATGGAGTTGTGGTGGATGGAAGCTGTGATGTGGATGAGAAAACATTGACAGGAGAGTCATTCCCTGTCTCCAAACAGAGAGATTCAACTGTTTTGG CTGCAACCATAAATCTTAATGGTTATATAAAGGTGAAAACTACAGCTCTAGCCCGGGACTGCGTAGTCGCGAAAATGACTAAGCTTGTAGAAGAAGCTCAAAAAAGCCAAACCAAAACTCAAAGGTTTATAGATAAATGTTCT CGCTACTACACTCCAGCTGTTGTCGTGTTAGCAGCATGTTTTGCGGTGATCCCGGTATTGTTAAAGCTTCAGGACCTTAGCCATTGGTTTCACTTAGCACTTGTAGTGTTAGTAAGTGGTTGTCCATGTGGTCTTATCTTATC CACACCTATTGCTACCTTTTGTGCTCTCACTAAGGCAGCCATGTCGGGGTTTCTGATCAAAACTGGTGATTGTCTAGAGACTCTTGCAAAGATCAAGATTGTTGCTTTTGACAAAACAGGAACTATTACAAAGGCT<span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span>A TGGTCTCGGATTTTAGGTCTCTTTCTCACAATATCAATCTGCACAACTTGCTTTACTGGGTCTCGAGCATTGAGAGCAAGTCAAGTCATCCGATGGCAGCGGCGCTTATTGACTATGCAAGATCAGTTTCTGTTGAGCCTAAG CCTGATCTCGTTGAGAACTTTCAAAACTTTCCAGGAGAAGGAGTTTATGGGAGAATAGATGGTCAAGATATCTACATTGGAAACAAAAGAATTGCACAGAGAGCTGGATGCTTAACAGTTCCGGATATGGAAGCTAATATGAA GCGAGGTAAGACCATTGGTTACATATACATTGGAGCAAAACTGTCCGGAAGTTTCAACCTTATTGACAGTTGTCGATATGGGGTTGCTCAAGCTCTCAAGGAGCTCAAGTCTTTAGGAATCAAAACTGCAATGCTCACAGGAG ATAACCGAGACGCAGCCCTGTCTACTCAAGAACAGTTAGAGAATGCTTTGGATATTGTTCACTCTGAACTCCTTCCACAAGACAAAGCAAGAATCATCGAT<span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span>AAGATCCAAGGGCCTACAATGATGGTAGGAGACGGG CTTAACGATGCACCGGCTTTAGCGAAAGCAGACATTGGCCTTTCAATGGGGATCTCAGGGTCAGCACTTGCAACAGAGACAGGAGACATCATTCTTATGTCAAACGATATAAGGAAGATCCCGAAAGGGATGAGACTAGCGAA GAGAAGTCATAAGAAAGTGATTGAGAATGTTGTTTTGTCTGTGAGCATAAAAGGAGCAATCATGGTTCTTGCTTTTGTAGGTTACCCTCTGGTTTGGGCAGCTGTACTTGCAGATGCAGGAACTTGTTTGCTTGTGATACTCA ATAGTATGATGCTTCTACGCGATGAGCGTGAAGCCGTGTCTACATGTTACCGTGCTTCTTCTTCGCCGGTGAAACTTGAGGAGGATGAAGCAGAGGATCTAGAAGTTGGCTTGTTGCAGAAGAGTGAGGAGACAAATAAAAAG
+
</div>
−
AGTTGTTGCTCTGGTTCTTGTAGTGGCCCTAAGGACAATCAACAAAAGTGA<span class= "highlightLightBlue">CTGCAG</span></span>
+
 
 +
<div class="clear extra_space"></div>
 +
<div class="line_divider"></div>
 +
<div class="clear extra_space"></div>
 +
 
 +
 
 +
<div class="column third_size">
 +
<h3>2nd idea <br>- Separating the sequence</h3>
 +
<p> The second option is to separate our whole promoter and gene sequence into 4 fragment parts. You can see the parts in the table to the right-hand side. </p>
 +
</div>
 +
 
 +
<div class="column two_thirds_size">
 +
<table>  
 +
  <tr>  
 +
      <td colspan="2"></td>
 +
      <td colspan="4"> <center> Restriction site at the </center></td> 
 +
  </tr>
 +
  <tr>
 +
      <th> Sequence </th>
 +
      <th> Length [bp]</th>
 +
      <th> beginning of the sequence</th>
 +
      <th> end of the sequence</th>
 +
  </tr> 
 +
  <tr>
 +
      <td> IDT <br> 1. Part sequence</td>
 +
      <td> 614</td>
 +
      <td> EcorRI: G/AATTC</td>  
 +
      <td> HindIII: A/AGCTT</td>  
 +
  </tr>
 +
  <tr>
 +
      <td> IDT <br> 2. Part sequence</td>
 +
      <td> 593</td>
 +
      <td> HindIII: A/AGCTT</td>
 +
      <td> SmaI: CCC/GGG; blunt end</td>
 +
  </tr>
 +
  <tr>
 +
      <td> IDT <br> 3. Part sequence</td>
 +
      <td> 556</td>
 +
      <td> SmaI: CCC/GGG; blunt end</td>
 +
      <td> EcoRII: -/CCWGG; W=A/T</td>
 +
  </tr>
 +
  <tr>
 +
      <td> IDT <br> 4. Part sequence</td>
 +
      <td> 885</td>
 +
      <td> EcoRII: -/CCWGG; W=A/T</td>
 +
      <td> PstI: CTGCA/G</td>
 +
  </tr>  
 +
  <tr>  
 +
      <td> Total length of the synthesized fragments</td>  
 +
      <td> 2648</td>
 +
      <td> </td>
 +
      <td> </td>
 +
  </tr>
 +
  <tr>
 +
      <td> Length of the sequence after the ligation</td>
 +
      <td> 2613 </td>
 +
      <td> </td>
 +
      <td> </td>
 +
  </tr>
 +
</table>  
 
</p>
 
</p>
−
</span>
 
 
</div>
 
</div>
 +
 +
<div class="clear"></div>
 +
 +
<div class="column full_size" >
 +
<p>The following part shows the 4 fragments, which were synthesized by the IDT. The black letters indicates the promoter sequence and the green letters the HMA3 gene sequence. The restriction sites for each restriction enzyme are highlighted in different colors to clearly differentiate inbetween them. To ligate these fragments into the vector pSB1C3, the first fragment needs to have the restriction site of EcoRI at the beginning as well as the fourth fragment needs to end with the restriction site of PstI. For this sequence design, we also have to changed a few codons to make sure that EcoRI and HindIII will not cut several times in the sequence.
 +
All four fragments will bind together because of the different restriction sites. For example, the end of the first fragment and the beginning of the second fragment have the same restriction site. This means only one end fits the other end.
 +
</p>
 
</div>
 
</div>
  
 +
<div class="column third_size">
 +
<p><b> 1st fragment</b></p>
 +
<p>Length: 614 bp</p>
  
 +
<p><b>Restriction enzymes</b><br>
 +
      EcoRI: <span class="highlightYellow">G/AATTC</span> <br>
 +
      HindIII: <span class="highlightRed">A/AGCTT </span> <br>
 +
      <span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span> = changed codon to make sure that EcoRI will not cut several times
 +
</p>
 +
</div>
  
 +
<div class="column two_thirds_size">
 +
<img src="https://static.igem.org/mediawiki/2018/6/6a/T--HSHL--fragment01.png">
 +
</div>
 +
<div class="clear"></div>
 +
<div class="column third_size">
 +
<p><b>2nd fragment</b></p>
 +
<p>Length: 593 bp</p>
 +
<p><b>Restriction enzymes</b><br>
 +
      HindIII: <span class="highlightRed">A/AGCTT </span> <br>
 +
      SmaI: <span class="highlightGreen">CCC/GGG</span>; blunt end
 +
</p>
 +
</div>
  
 +
<div class="column two_thirds_size">
 +
<img src="https://static.igem.org/mediawiki/2018/a/a3/T--HSHL--fragment02.png">
 +
</div>
 +
 +
<div class="clear"></div>
 +
 +
<div class="column third_size">
 +
<p><b>3rd fragment</b></p>
 +
<p>Length: 556 bp</p>
 +
 +
<p><b>Restriction enzymes</b><br>
 +
      SmaI: <span class="highlightGreen">CCC/GGG</span>; blunt end <br>
 +
      EcoRII: <span class="highlightPurple">-/CCWGG</span>; W=A/T <br>
 +
      <span class="highlightGrey">AAGC</span><span class="highlightRed">T</span> = changed codon at the restriction site to make sure that HindIII will not cut several times
 +
</p>
 +
</div>
 +
 +
<div class="column two_thirds_size">
 +
<img src="https://static.igem.org/mediawiki/2018/4/49/T--HSHL--fragment03.png">
 +
</div>
 +
 +
<div class="clear"></div>
 +
 +
<div class="column third_size">
 +
<p><b>4th fragment</b></p>
 +
<p>Length: 885 bp</p>
 +
 +
<p><b>Restriction enzymes</b><br>
 +
      EcoRII: <span class="highlightPurple">-/CCWGG</span>; W=A/T <br>
 +
      PstI: <span class="highlightLightBlue">CTGCA/G </span>
 +
</p>
 +
</div>
 +
 +
<div class="column two_thirds_size">
 +
<img src="https://static.igem.org/mediawiki/2018/b/b5/T--HSHL--fragment04.png">
 +
</div>
  
 
<div class="clear extra_space"></div>
 
<div class="clear extra_space"></div>

Latest revision as of 20:42, 17 October 2018

HOME
ABOUT US
Team
University
Collaborations & Networking
PROJECT
Description
Design
Experiments
Results
Attributions
PARTS
SAFETY
HUMAN PRACTICES
AWARDS
Applied Design
Entrepreneurship
Hardware
Measurement
Model
Plant
Software
CONTACT & COPYRIGHT
JUDGING FORM ⇗

Design

1st idea
- Working with the whole sequence

The HMA3 Sequence is with 2619 bp quite big which make it a little bit difficult for us to actually isolate this sequence out of the A. halleri. That is the reason why we decided to get it synthesized by IDT.

First option was to use the whole sequence (2631 bp). A CaMV 35S (universal promoter, Cauliflower Mosaic Virus) is used as a promoter with a length of 345 bp.

For our Biobrick we decided to use the Vector called pSB1C3 with a chloramphenicol resistance. By including the sequence of the restriction sites of EcoRI at the beginning and PstI at the end of our sequence, which are the same restriction sites for the plasmide, we can insert our sequence into our targeted vector. In our specific case EcoRI would cut about two times into our Gene HMA3 for example. To make sure the restriction enzyme will not cut several times into our sequence we had to change some codons in the original sequence of our Gene HMA3 (you can see the changes of the codons below in red).

Sequence Length [bp] Color
CaMV 35S promoter 345 letters
AhHMA3 cDNA 2274 highlighted
Restriction site of EcoRI (G/AATTC) 6 highlighted
restriction site of PstI (CTGCA/G) 6 highlighted
whole sequence 2613

Promoter and gene sequence

In the following the whole promoter and gene sequence including the restriction sites to ligate into the vector pSB1C3 is shown.
GAGTTC = changed codon to make sure that EcoRI will not cut several times

2nd idea
- Separating the sequence

The second option is to separate our whole promoter and gene sequence into 4 fragment parts. You can see the parts in the table to the right-hand side.

Restriction site at the
Sequence Length [bp] beginning of the sequence end of the sequence
IDT
1. Part sequence		 614 EcorRI: G/AATTC HindIII: A/AGCTT
IDT
2. Part sequence		 593 HindIII: A/AGCTT SmaI: CCC/GGG; blunt end
IDT
3. Part sequence		 556 SmaI: CCC/GGG; blunt end EcoRII: -/CCWGG; W=A/T
IDT
4. Part sequence		 885 EcoRII: -/CCWGG; W=A/T PstI: CTGCA/G
Total length of the synthesized fragments 2648
Length of the sequence after the ligation 2613

The following part shows the 4 fragments, which were synthesized by the IDT. The black letters indicates the promoter sequence and the green letters the HMA3 gene sequence. The restriction sites for each restriction enzyme are highlighted in different colors to clearly differentiate inbetween them. To ligate these fragments into the vector pSB1C3, the first fragment needs to have the restriction site of EcoRI at the beginning as well as the fourth fragment needs to end with the restriction site of PstI. For this sequence design, we also have to changed a few codons to make sure that EcoRI and HindIII will not cut several times in the sequence. All four fragments will bind together because of the different restriction sites. For example, the end of the first fragment and the beginning of the second fragment have the same restriction site. This means only one end fits the other end.

1st fragment

Length: 614 bp

Restriction enzymes
EcoRI: G/AATTC
HindIII: A/AGCTT
GAGTTC = changed codon to make sure that EcoRI will not cut several times

2nd fragment

Length: 593 bp

Restriction enzymes
HindIII: A/AGCTT
SmaI: CCC/GGG; blunt end

3rd fragment

Length: 556 bp

Restriction enzymes
SmaI: CCC/GGG; blunt end
EcoRII: -/CCWGG; W=A/T
AAGCT = changed codon at the restriction site to make sure that HindIII will not cut several times

4th fragment

Length: 885 bp

Restriction enzymes
EcoRII: -/CCWGG; W=A/T
PstI: CTGCA/G

This wiki is designed by HSHL within the iGEM 2018 template.
Instagram | Twitter | University | Fundraiser | E-Mail