Difference between revisions of "Team:HebrewU/Parts"
| (14 intermediate revisions by the same user not shown) | |||
| Line 7: | Line 7: | ||
<!--- Own CSS ---> | <!--- Own CSS ---> | ||
<link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css"> | <link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css"> | ||
| − | |||
| − | |||
| − | |||
<!--- Main Menu script ---> | <!--- Main Menu script ---> | ||
| Line 27: | Line 24: | ||
#content { padding:0px; width:100%; margin-top:-12px; margin-left:0px;} | #content { padding:0px; width:100%; margin-top:-12px; margin-left:0px;} | ||
#body {background-color:#EDEADC; } | #body {background-color:#EDEADC; } | ||
| − | #bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent | + | #bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent p { margin-bottom: 0px; } |
.w3-container { | .w3-container { | ||
| Line 68: | Line 65: | ||
} | } | ||
| + | |||
| + | body { | ||
| + | background-color:blue-gray; | ||
| + | color: #e4e4e4; | ||
| + | font-family:Tahoma, Geneva, sans-serif; | ||
| + | } | ||
| + | |||
| + | #HQ_page p { | ||
| + | font-family: Tahoma, Geneva, sans-serif; | ||
| + | color: #e4e4e4; | ||
| + | } | ||
| + | |||
| + | |||
</style> | </style> | ||
| Line 112: | Line 122: | ||
<li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li> | <li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li> | ||
<li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li> | <li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li> | ||
| − | <li><a href="https://2018.igem.org/Team:HebrewU/ | + | <li><a href="https://2018.igem.org/Team:HebrewU/Demonstrate">Results</a></li> |
<li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li> | <li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li> | ||
| − | <li><a href="https://2018.igem.org/Team:HebrewU/Software"> | + | <li><a href="https://2018.igem.org/Team:HebrewU/Software">MOOLTi</a></li> |
</ul> | </ul> | ||
| Line 166: | Line 176: | ||
<a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a> | <a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a> | ||
<a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a> | <a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a> | ||
| − | <a href="https://2018.igem.org/Team:HebrewU/ | + | <a href="https://2018.igem.org/Team:HebrewU/Demonstrate"><button class="b_huji_small_subnav">Results</button></a> |
<a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a> | <a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a> | ||
| − | <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav"> | + | <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav">MOOLTi</button></a> |
</div> | </div> | ||
| Line 232: | Line 242: | ||
} | } | ||
</script> | </script> | ||
| + | |||
| + | <a onClick="topFunction()" id="myBtn_up" title="Go to top"><img src="https://static.igem.org/mediawiki/2018/1/1e/T--hebrewu--arrow_up.png" width="40px" /></a> | ||
| + | |||
| + | |||
| + | <script> | ||
| + | // When the user scrolls down 20px from the top of the document, show the button | ||
| + | window.onscroll = function() {scrollFunction()}; | ||
| + | |||
| + | function scrollFunction() { | ||
| + | if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) { | ||
| + | document.getElementById("myBtn_up").style.display = "block"; | ||
| + | } else { | ||
| + | document.getElementById("myBtn_up").style.display = "none"; | ||
| + | } | ||
| + | } | ||
| + | |||
| + | // When the user clicks on the button, scroll to the top of the document | ||
| + | function topFunction() { | ||
| + | document.body.scrollTop = 0; | ||
| + | document.documentElement.scrollTop = 0; | ||
| + | } | ||
| + | </script> | ||
<!------------ HP start -------------> | <!------------ HP start -------------> | ||
| Line 237: | Line 269: | ||
<!-- Header --> | <!-- Header --> | ||
| − | < | + | <div class="w3-center w3-animate-bottom"> |
| − | + | <img src="https://static.igem.org/mediawiki/2018/c/c5/T--hebrewu--PARTS_HL.png" width="20%"> | |
| + | <br /> <br /> <br /> | ||
| − | <a href="#Gal_main_toggle"><button class="w3-button | + | |
| − | <a href="#Gibson_main_toggle"><button class="w3-button | + | <a href="#Gal_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gal 1/10</button> </a> |
| + | <a href="#Gibson_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gibson brick</button></a> | ||
<!-- Gal 1/10 Grid --> | <!-- Gal 1/10 Grid --> | ||
| − | <div id="Gal_main_toggle" class=" | + | <div id="Gal_main_toggle" class="w3-container w3-content"> |
<h1 class="w3-center">Gal 1/10</h1> <br /> | <h1 class="w3-center">Gal 1/10</h1> <br /> | ||
| − | < | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> |
GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. | GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. | ||
Each complimentary strand promotes translation in opposing directions. | Each complimentary strand promotes translation in opposing directions. | ||
Galactose induces transcription, while Glucose serves as a repressor. | Galactose induces transcription, while Glucose serves as a repressor. | ||
| − | The promoter is inducible by as low as 2% Galactose in medium. < | + | The promoter is inducible by as low as 2% Galactose the in medium. </p> <br /> |
<div class="w3-center"> | <div class="w3-center"> | ||
| − | <img src="https://static.igem.org/mediawiki/ | + | <img src="https://static.igem.org/mediawiki/2018/7/7d/T--hebrewu--parts_plasmid.png" width="50%"> |
</div> <br /><br /><br /> | </div> <br /><br /><br /> | ||
| − | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> | |
| + | |||
It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits, | It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits, | ||
| − | or can simply be used to effectively cut the | + | or can simply be used to effectively cut the number of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.<br /> |
| − | To validate this part we | + | To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector, |
| − | containing two subunits of the same protein- 44a-Dioxygenase (44a) . | + | containing two subunits of the same protein- 44a-Dioxygenase (44a). |
This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS). | This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS). | ||
We used Leu2 as a regulating gene, as it is found on the same plasmid, | We used Leu2 as a regulating gene, as it is found on the same plasmid, | ||
| − | but | + | but its transcription is not dependent on the Gal 1/10 Promoter.<br /><br /> |
We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br /> | We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br /> | ||
| − | + | ||
| − | + | 1. 44a- Containing the vector shown in the map above, | |
| − | with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1. | + | with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.<br/> |
| − | + | 2. CTRL strain, containing a similar but "empty" vector. | |
| − | This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted. | + | This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.<br/> |
| − | + | ||
| − | </ | + | </p> |
<div class="w3-center"> | <div class="w3-center"> | ||
| − | <img src="https://static.igem.org/mediawiki/ | + | <img src="https://static.igem.org/mediawiki/2018/4/46/T--hebrewu--Parts_table.png" width="100%"> |
</div><br/> | </div><br/> | ||
| − | < | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> |
After growth, be split each strain into 2 treatments:<br /><br /> | After growth, be split each strain into 2 treatments:<br /><br /> | ||
| − | + | ||
| − | + | 1. Induced: SG media, containing 2% galactose in the media. <br/> | |
| − | + | 2. Uninduced: SD media, containing 2% glucose in the media. <br/> | |
| − | + | ||
As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments. | As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments. | ||
| Line 293: | Line 328: | ||
In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment. <br/> | In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment. <br/> | ||
Additionally, we see approximately equal expression between the uninduced treatment and the control group, | Additionally, we see approximately equal expression between the uninduced treatment and the control group, | ||
| − | indicating the minor levels could be background noise caused by non-specificity of primers, or primer dimer amplification. | + | indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification. |
| − | (We used SYBR, and not a probe, | + | (We used SYBR, and not a probe, therefore the possibility of such background noise arises) |
| − | </ | + | </p> |
</div> | </div> | ||
| Line 301: | Line 336: | ||
<div id="Gibson_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content"> | <div id="Gibson_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content"> | ||
<h1 class="w3-center">Gibson brick</h1> <br /> | <h1 class="w3-center">Gibson brick</h1> <br /> | ||
| − | < | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> |
An obstacle many team face is finding a way to assemble multiple genetic components into a single | An obstacle many team face is finding a way to assemble multiple genetic components into a single | ||
plasmid effectively and quickly. Though the biobrick standard addresses this issue, | plasmid effectively and quickly. Though the biobrick standard addresses this issue, | ||
| Line 307: | Line 342: | ||
We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction | We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction | ||
is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful. | is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful. | ||
| − | Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning | + | Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector. |
This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment. | This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment. | ||
| − | Each of our oligos | + | Each of our oligos is approximately 40 Bp long, consisting of two components:<br /><br /> |
| − | + | ||
| − | + | ||
| − | 1. Biobrick prefix / suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library. | + | 1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library. |
| − | </ | + | <br /> |
| − | + | ||
2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly. | 2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly. | ||
| − | </ | + | <br /><br /> |
| − | + | ||
This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction | This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction | ||
| − | stitch them all together into a plasmid, ready for transformation. | + | stitch them all together into a plasmid, ready for transformation. </p> |
| − | + | ||
| − | + | ||
<div class="w3-center"> | <div class="w3-center"> | ||
<img src="https://static.igem.org/mediawiki/2018/6/64/T--HebrewU--GibsonBricksmall.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2018/6/64/T--HebrewU--GibsonBricksmall.png" width="60%"> | ||
</div> <br /><br /><br /> | </div> <br /><br /><br /> | ||
| − | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> | |
Parts in Registry: <br /> <br /> | Parts in Registry: <br /> <br /> | ||
| − | <table class="w3-table w3-striped w3-white"> | + | <table class="w3-table w3-striped w3-white" style="color:black;"> |
<tr> | <tr> | ||
<th> | <th> | ||
| − | + | <strong>BioBrick</strong> | |
</th> | </th> | ||
<th> | <th> | ||
| − | + | <strong>Name</strong> | |
</th> | </th> | ||
<th> | <th> | ||
| − | + | <strong>Sequence</strong> | |
</th> | </th> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667002 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 1 Fw | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667003 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 1 Rv | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667004 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 2 Fw | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667005 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 2 Rv | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667006 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 3 Fw | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667007 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 3 Rv | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667008 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 4 Fw | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td> | ||
| − | + | BBa_K2667009 | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | GibsonBrick 4 Rv | |
</td> | </td> | ||
<td> | <td> | ||
| − | + | TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG | |
</td> | </td> | ||
</tr> | </tr> | ||
| Line 432: | Line 465: | ||
<br /> <br /> | <br /> <br /> | ||
| − | + | <p class="w3-justify" style="padding-right:30px;padding-left:30px;"> | |
| + | |||
Fragments should be amplified in the following order: <br /><br /> | Fragments should be amplified in the following order: <br /><br /> | ||
| − | + | ||
| − | + | Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv.<br/> | |
| − | + | Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv. <br/> | |
| − | + | Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv. <br/> | |
| − | + | Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv. <br/> | |
| − | + | Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.<br/><br/> | |
| − | + | ||
| − | The Custom vector primers should contain the Prefix and Suffix respectively, along with | + | The Custom vector primers should contain the Prefix and Suffix respectively, along with |
| − | homologous regions that will allow for assembly with the Vector your team is using. <br/> | + | homologous regions that will allow for assembly with the Vector your team is using. </p><br/> |
</div> | </div> | ||
Latest revision as of 17:30, 12 December 2018
Hebrew- Project
- Lab
- Human Practices
- Team
- Judging
Gal 1/10
GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. Each complimentary strand promotes translation in opposing directions. Galactose induces transcription, while Glucose serves as a repressor. The promoter is inducible by as low as 2% Galactose the in medium.
It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits,
or can simply be used to effectively cut the number of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.
To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector,
containing two subunits of the same protein- 44a-Dioxygenase (44a).
This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS).
We used Leu2 as a regulating gene, as it is found on the same plasmid,
but its transcription is not dependent on the Gal 1/10 Promoter.
We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:
1. 44a- Containing the vector shown in the map above,
with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.
2. CTRL strain, containing a similar but "empty" vector.
This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.
After growth, be split each strain into 2 treatments:
1. Induced: SG media, containing 2% galactose in the media.
2. Uninduced: SD media, containing 2% glucose in the media.
As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments.
The results of this experiment are detailed in the graph below.
After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented.
In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.
Additionally, we see approximately equal expression between the uninduced treatment and the control group,
indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification.
(We used SYBR, and not a probe, therefore the possibility of such background noise arises)
Gibson brick
An obstacle many team face is finding a way to assemble multiple genetic components into a single
plasmid effectively and quickly. Though the biobrick standard addresses this issue,
we found that using newer, more advanced methods of can help save time and resources.
We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction
is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful.
Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector.
This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment.
Each of our oligos is approximately 40 Bp long, consisting of two components:
1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly.
This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction
stitch them all together into a plasmid, ready for transformation.
Parts in Registry:
| BioBrick | Name | Sequence |
|---|---|---|
| BBa_K2667002 | GibsonBrick 1 Fw | GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG |
| BBa_K2667003 | GibsonBrick 1 Rv | TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC |
| BBa_K2667004 | GibsonBrick 2 Fw | CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG |
| BBa_K2667005 | GibsonBrick 2 Rv | TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG |
| BBa_K2667006 | GibsonBrick 3 Fw | CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG |
| BBa_K2667007 | GibsonBrick 3 Rv | TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG |
| BBa_K2667008 | GibsonBrick 4 Fw | TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG |
| BBa_K2667009 | GibsonBrick 4 Rv | TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG |
Fragments should be amplified in the following order:
Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv.
Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv.
Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv.
Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv.
Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.
The Custom vector primers should contain the Prefix and Suffix respectively, along with
homologous regions that will allow for assembly with the Vector your team is using.