Difference between revisions of "Team:HebrewU/Parts"

 
(11 intermediate revisions by the same user not shown)
Line 7: Line 7:
 
<!--- Own CSS --->
 
<!--- Own CSS --->
 
<link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css">
 
<link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css">
−
 
−
<!--- Jquery script - ****** remove when uploading to wiki ********** --->
 
−
<script src="https://ajax.googleapis.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script>
 
  
 
<!--- Main Menu script --->
 
<!--- Main Menu script --->
Line 125: Line 122:
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li>
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li>
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li>
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li>
−
             <li><a href="https://2018.igem.org/Team:HebrewU/Results">Results</a></li>
+
             <li><a href="https://2018.igem.org/Team:HebrewU/Demonstrate">Results</a></li>
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li>
 
             <li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li>
−
             <li><a href="https://2018.igem.org/Team:HebrewU/Software">Moolti</a></li>
+
             <li><a href="https://2018.igem.org/Team:HebrewU/Software">MOOLTi</a></li>
  
 
         </ul>         
 
         </ul>         
Line 179: Line 176:
 
             <a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a>
 
             <a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a>
 
             <a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a>
 
             <a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a>
−
             <a href="https://2018.igem.org/Team:HebrewU/Results"><button class="b_huji_small_subnav">Results</button></a>
+
             <a href="https://2018.igem.org/Team:HebrewU/Demonstrate"><button class="b_huji_small_subnav">Results</button></a>
 
             <a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a>
 
             <a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a>
−
             <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav">Moolti</button></a>
+
             <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav">MOOLTi</button></a>
 
         </div>
 
         </div>
  
Line 245: Line 242:
 
     }
 
     }
 
     </script>
 
     </script>
 +
   
 +
    <a onClick="topFunction()" id="myBtn_up" title="Go to top"><img src="https://static.igem.org/mediawiki/2018/1/1e/T--hebrewu--arrow_up.png" width="40px" /></a>
 +
 +
 +
<script>
 +
// When the user scrolls down 20px from the top of the document, show the button
 +
window.onscroll = function() {scrollFunction()};
 +
 +
function scrollFunction() {
 +
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
        document.getElementById("myBtn_up").style.display = "block";
 +
    } else {
 +
        document.getElementById("myBtn_up").style.display = "none";
 +
    }
 +
}
 +
 +
// When the user clicks on the button, scroll to the top of the document
 +
function topFunction() {
 +
    document.body.scrollTop = 0;
 +
    document.documentElement.scrollTop = 0;
 +
}
 +
</script>
 
<!------------ HP start ------------->
 
<!------------ HP start ------------->
  
Line 250: Line 269:
  
 
<!-- Header -->
 
<!-- Header -->
−
             <div class="w3-center">
+
             <div class="w3-center w3-animate-bottom">
 
             <img src="https://static.igem.org/mediawiki/2018/c/c5/T--hebrewu--PARTS_HL.png" width="20%">
 
             <img src="https://static.igem.org/mediawiki/2018/c/c5/T--hebrewu--PARTS_HL.png" width="20%">
−
           <br />
+
           <br /> <br /> <br />
  
  
−
<a href="#Gal_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;">Gal 1/10</button> </a>
+
<a href="#Gal_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gal 1/10</button> </a> &nbsp; &nbsp;
−
     <a href="#Gibson_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;">Gibson brick</button></a>
+
     <a href="#Gibson_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gibson brick</button></a>
 
      
 
      
 
      
 
      
 
<!-- Gal 1/10 Grid -->
 
<!-- Gal 1/10 Grid -->
−
<div id="Gal_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content">
+
<div id="Gal_main_toggle" class="w3-container w3-content">
 
       <h1 class="w3-center">Gal 1/10</h1> <br />  
 
       <h1 class="w3-center">Gal 1/10</h1> <br />  
 
       <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  
 
       <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  
Line 266: Line 285:
 
               Each complimentary strand promotes translation in opposing directions.  
 
               Each complimentary strand promotes translation in opposing directions.  
 
               Galactose induces transcription, while Glucose serves as a repressor.  
 
               Galactose induces transcription, while Glucose serves as a repressor.  
−
               The promoter is inducible by as low as 2% Galactose in medium. </p> <br /><br /><br />
+
               The promoter is inducible by as low as 2% Galactose the in medium. </p> <br />
 
          
 
          
 
             <div class="w3-center">
 
             <div class="w3-center">
−
             <img src="https://static.igem.org/mediawiki/parts/3/33/T--HebrewU--GalBrickMap.png" width="60%">
+
             <img src="https://static.igem.org/mediawiki/2018/7/7d/T--hebrewu--parts_plasmid.png" width="50%">
 
             </div> <br /><br /><br />
 
             </div> <br /><br /><br />
 
           <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  
 
           <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  
  
 
             It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits,  
 
             It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits,  
−
             or can simply be used to effectively cut the amount of plasmids required  for cloning in half, as two genes can be cloned into a single plasmid.<br />
+
             or can simply be used to effectively cut the number of plasmids required  for cloning in half, as two genes can be cloned into a single plasmid.<br />
 
      
 
      
−
             To validate this part we preformed Real-Time PCR on yeast with our Leu-44a vector,
+
             To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector,
−
             containing two subunits of the same protein- 44a-Dioxygenase (44a) .
+
             containing two subunits of the same protein- 44a-Dioxygenase (44a).
 
             This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS).  
 
             This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS).  
 
             We used Leu2 as a regulating gene, as it is found on the same plasmid,  
 
             We used Leu2 as a regulating gene, as it is found on the same plasmid,  
−
             but it transcription is not dependent on the Gal 1/10 Promoter.<br /><br />  
+
             but its transcription is not dependent on the Gal 1/10 Promoter.<br /><br />  
 
              
 
              
 
             We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br />
 
             We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br />
 
              
 
              
−
                 1. 44a- Containing the vector showed in the map above,  
+
                 1. 44a- Containing the vector shown in the map above,  
 
                     with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.<br/>
 
                     with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.<br/>
 
                 2. CTRL strain, containing a similar but "empty" vector.  
 
                 2. CTRL strain, containing a similar but "empty" vector.  
Line 291: Line 310:
 
         </p>
 
         </p>
 
         <div class="w3-center">
 
         <div class="w3-center">
−
             <img src="https://static.igem.org/mediawiki/parts/e/ed/T--HebrewU--GalBrickGraph.png" width="80%">
+
             <img src="https://static.igem.org/mediawiki/2018/4/46/T--hebrewu--Parts_table.png" width="100%">
 
         </div><br/>
 
         </div><br/>
 
          
 
          
Line 309: Line 328:
 
             In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.  <br/>  
 
             In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.  <br/>  
 
             Additionally, we see approximately equal expression between the uninduced treatment and the control group,  
 
             Additionally, we see approximately equal expression between the uninduced treatment and the control group,  
−
             indicating the minor levels could be background noise caused by non-specificity of primers, or primer dimer amplification.  
+
             indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification.  
−
             (We used SYBR, and not a probe, therefor the possibility of such background noise arises)  
+
             (We used SYBR, and not a probe, therefore the possibility of such background noise arises)  
 
         </p>
 
         </p>
 
</div>
 
</div>
Line 323: Line 342:
 
               We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction  
 
               We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction  
 
               is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful.  
 
               is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful.  
−
  Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning in to a single vector.  
+
  Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector.  
 
  This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment.  
 
  This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment.  
−
               Each of our oligos are approximately 40 Bp long, consisting of two components:<br /><br />
+
               Each of our oligos is approximately 40 Bp long, consisting of two components:<br /><br />
 
                
 
                
 
                      
 
                      
−
                     1. Biobrick prefix / suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
+
                     1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
 
                     <br />
 
                     <br />
 
                      
 
                      
Line 343: Line 362:
 
             Parts in Registry: <br /> <br />
 
             Parts in Registry: <br /> <br />
 
      
 
      
−
<table class="w3-table w3-striped w3-white">
+
<table class="w3-table w3-striped w3-white" style="color:black;">
 
             <tr>
 
             <tr>
 
                 <th>
 
                 <th>
−
                 <p><strong>BioBrick</strong></p>
+
                 <strong>BioBrick</strong>
 
                 </th>
 
                 </th>
 
                 <th>
 
                 <th>
−
                 <p><strong>Name</strong></p>
+
                 <strong>Name</strong>
 
                 </th>
 
                 </th>
 
                 <th>
 
                 <th>
−
                 <p><strong>Sequence</strong></p>
+
                 <strong>Sequence</strong>
 
                 </th>
 
                 </th>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667002</p>
+
                 BBa_K2667002
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 1 Fw</p>
+
                 GibsonBrick 1 Fw
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG</p>
+
                 GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667003</p>
+
                 BBa_K2667003
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 1 Rv</p>
+
                 GibsonBrick 1 Rv
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC</p>
+
                 TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667004</p>
+
                 BBa_K2667004
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 2 Fw</p>
+
                 GibsonBrick 2 Fw
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG</p>
+
                 CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667005</p>
+
                 BBa_K2667005
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 2 Rv</p>
+
                 GibsonBrick 2 Rv
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG</p>
+
                 TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667006</p>
+
                 BBa_K2667006
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 3 Fw</p>
+
                 GibsonBrick 3 Fw
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG</p>
+
                 CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667007</p>
+
                 BBa_K2667007
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 3 Rv</p>
+
                 GibsonBrick 3 Rv
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG</p>
+
                 TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667008</p>
+
                 BBa_K2667008
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 4 Fw</p>
+
                 GibsonBrick 4 Fw
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG</p>
+
                 TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
             <tr>
 
             <tr>
 
                 <td>
 
                 <td>
−
                 <p>BBa_K2667009</p>
+
                 BBa_K2667009
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>GibsonBrick 4 Rv</p>
+
                 GibsonBrick 4 Rv
 
                 </td>
 
                 </td>
 
                 <td>
 
                 <td>
−
                 <p>TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG</p>
+
                 TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG
 
                 </td>
 
                 </td>
 
             </tr>
 
             </tr>
 
</table>
 
</table>
−
             </p>
+
              
 
             <br /> <br />
 
             <br /> <br />
 
             <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  
 
             <p class="w3-justify" style="padding-right:30px;padding-left:30px;">  

Latest revision as of 17:30, 12 December 2018

HebrewU HujiGEM 2018






   

Gal 1/10


GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. Each complimentary strand promotes translation in opposing directions. Galactose induces transcription, while Glucose serves as a repressor. The promoter is inducible by as low as 2% Galactose the in medium.





It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits, or can simply be used to effectively cut the number of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.
To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector, containing two subunits of the same protein- 44a-Dioxygenase (44a). This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS). We used Leu2 as a regulating gene, as it is found on the same plasmid, but its transcription is not dependent on the Gal 1/10 Promoter.

We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:

1. 44a- Containing the vector shown in the map above, with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.
2. CTRL strain, containing a similar but "empty" vector. This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.


After growth, be split each strain into 2 treatments:

1. Induced: SG media, containing 2% galactose in the media.
2. Uninduced: SD media, containing 2% glucose in the media.
As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments. The results of this experiment are detailed in the graph below. After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented.

In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.
Additionally, we see approximately equal expression between the uninduced treatment and the control group, indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification. (We used SYBR, and not a probe, therefore the possibility of such background noise arises)

Gibson brick


An obstacle many team face is finding a way to assemble multiple genetic components into a single plasmid effectively and quickly. Though the biobrick standard addresses this issue, we found that using newer, more advanced methods of can help save time and resources. We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful. Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector. This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment. Each of our oligos is approximately 40 Bp long, consisting of two components:

1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly.

This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction stitch them all together into a plasmid, ready for transformation.




Parts in Registry:

BioBrick Name Sequence
BBa_K2667002 GibsonBrick 1 Fw GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG
BBa_K2667003 GibsonBrick 1 Rv TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC
BBa_K2667004 GibsonBrick 2 Fw CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG
BBa_K2667005 GibsonBrick 2 Rv TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG
BBa_K2667006 GibsonBrick 3 Fw CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG
BBa_K2667007 GibsonBrick 3 Rv TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG
BBa_K2667008 GibsonBrick 4 Fw TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG
BBa_K2667009 GibsonBrick 4 Rv TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG


Fragments should be amplified in the following order:

Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv.
Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv.
Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv.
Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv.
Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.

The Custom vector primers should contain the Prefix and Suffix respectively, along with homologous regions that will allow for assembly with the Vector your team is using.