Difference between revisions of "Team:HebrewU/Parts"

(Prototype team page)
 
 
(15 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
{{HebrewU}}
+
<html lang="en">
−
<html>
+
<head>
 +
<title>HebrewU HujiGEM 2018</title>
 +
<meta charset="utf-8">
 +
<meta name="viewport" content="width=device-width, initial-scale=1">
  
 +
<!--- Own CSS --->
 +
<link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/CSS?action=raw&ctype=text/css">
  
−
<div class="column full_size">
+
<!--- Main Menu script --->
−
<h1>Parts</h1>
+
<script type="text/javascript" src="https://2018.igem.org/Template:Hebrewu/Javascript?action=raw&ctype=text/javascript"></script>
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
−
</div>
+
  
−
<div class="column full_size">
+
<!--- w3 Css --->
−
<div class="highlight decoration_background">
+
<link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/w3?action=raw&ctype=text/css">
−
<h3>Note</h3>
+
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
−
</div>
+
−
</div>
+
  
−
<div class="clear extra_space"></div>
+
<!--- Bootstrap Css --->
−
<div class="line_divider"></div>
+
  <script src="https://2018.igem.org/Template:HebrewU/boot?action=raw&ctype=text/javascript"></script>
−
<div class="clear extra_space"></div>
+
  <link rel="stylesheet" href="https://2018.igem.org/Template:HebrewU/strap?action=raw&ctype=text/css">
 +
 
 +
<style>
 +
/* Disable I-GEM defult properties for blank page */
 +
    #sideMenu, #top_title {display:none;}
 +
    #sideMenu, #sideMenu *, #top_menu_inside, #top_menu_inside *{box-sizing: initial; -webkit-box-sizing: initial;}
 +
    #content { padding:0px; width:100%; margin-top:-12px; margin-left:0px;}
 +
    #body {background-color:#EDEADC; }
 +
    #bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent p { margin-bottom: 0px; }
 +
 +
    .w3-container {
 +
  overflow: auto;
 +
    }
 +
 +
* {
 +
  -webkit-box-sizing:content-box ;
 +
    -moz-box-sizing:content-box ;
 +
    box-sizing:content-box ;
 +
    }
  
  
 +
.ahuji {
 +
    color:black
 +
    }
  
  
  
−
<div class="column two_thirds_size">
+
@media (max-width: 1000px) {
−
<div class="highlight decoration_B_full">
+
    .fixed {
 +
    display: none;
 +
    }
  
−
<h3>Adding parts to the registry</h3>
+
.ulogo { display:none; }
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
+
}
  
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
+
#panel, #flip_experts #panel_industry {
−
<div class="button_link">
+
    padding: 5px;
−
<a href="http://parts.igem.org/Add_a_Part_to_the_Registry">
+
    text-align: center;
−
ADD PARTS
+
}
−
</a>
+
−
</div>
+
  
−
</div>
+
#panel panel_industry{
−
</div>
+
    padding: 50px;
 +
    display: none;
 +
}
  
 +
body {
 +
background-color:blue-gray;
 +
 +
}
  
 +
body {
 +
background-color:blue-gray;
 +
color: #e4e4e4;
 +
font-family:Tahoma, Geneva, sans-serif;
 +
}
  
−
<div class="column third_size">
+
#HQ_page p {
−
<div class="highlight decoration_A_full">
+
    font-family: Tahoma, Geneva, sans-serif;
−
<h3>Inspiration</h3>
+
    color: #e4e4e4;
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
}
  
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
 
−
<ul>
 
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
 
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
 
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
 
−
</ul>
 
−
</div>
 
−
</div>
 
  
 +
</style>
  
−
<div class="clear extra_space"></div>
+
<script>
 +
function myFunction() {
 +
    var x = document.getElementById("Industry_display");
 +
    if (x.className.indexOf("w3-show") == -1) {
 +
        x.className += " w3-show";
 +
    } else {
 +
        x.className = x.className.replace(" w3-show", "");
 +
    }
 +
}
 +
</script>
  
 +
<script>
 +
function myFunction_2() {
 +
    var x = document.getElementById("Interviews_display");
 +
    if (x.className.indexOf("w3-show") == -1) {
 +
        x.className += " w3-show";
 +
    } else {
 +
        x.className = x.className.replace(" w3-show", "");
 +
    }
 +
}
 +
</script>
  
 +
<body>
 +
<div class="w3-blue-gray">
 +
<ul id="ddmenu_hebrewu">
 +
            <li style="float:left;margin-top:12px;padding-left:15px;"><br />Hebrew</li>
  
 +
    <div class="huji_homebutton">
 +
           
 +
        <a href="javascript:void(0);" class="icon" onClick="show_small_nav()">
 +
            <img src="https://static.igem.org/mediawiki/2018/d/dc/T--Hebrewu--huji_small_manu.png" width="20" height="20" padding:"2px">
 +
        </a>
 +
   
 +
        <a href="https://2018.igem.org/Team:HebrewU">
 +
                <img class="ulogo" src="https://static.igem.org/mediawiki/2018/d/d3/T--Hebrewu--huji_boiling_logo.png" width="60" height="60" style="margin-left:-27px;">
 +
                </a>
 +
  </div>
 +
 
 +
    <li><a>Project</a>
 +
        <ul>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Description">Description</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Model">Model</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Demonstrate">Results</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Parts">Parts</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Software">MOOLTi</a></li>
  
−
<div class="column full_size">
+
        </ul>       
 +
    </li>
 +
    <li><a>Lab</a>
 +
        <ul>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Design">Yeast Design</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Plant">Plant Design</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Notebook">Notebook</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/InterLab">Inter-lab</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Safety">Safety</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Protocols">Protocols</a></li>
 +
        </ul>
 +
       
 +
    </li>
 +
 
 +
   
 +
    <li><a href="https://2018.igem.org/Team:HebrewU/Human_Practices">Human Practices</a>
 +
        <ul>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Ethics">Ethics</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Global_aspects">Global Aspects</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Public_engagment">Public Engagment</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Open_Source">Open Source</a></li>
 +
        </ul>
 +
    </li>
 +
   
 +
    <li><a>Team</a>
 +
        <ul>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Team">Members</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Attributions">Attributions</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Collaborations">Collaborations</a></li>
 +
            <li><a href="https://2018.igem.org/Team:HebrewU/Photo_Gallery">Photo Gallery</a></li>
 +
        </ul>
 +
    </li>
 +
            <li ><a href="https://2018.igem.org/Team:HebrewU/Judging">Judging</a></li>
 +
           
 +
    <div class="social_huji">
 +
            <a href="https://twitter.com/GemHuji"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/3/39/T--Hebrewu--twitter_logo.png" width="25" height="25"></a>
 +
            <a href="https://www.facebook.com/HUJiGEM"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/8/8a/T--Hebrewu--facebook_logo.png" width="25" height="25"></a>
 +
            <a href="https://www.instagram.com/hujigem/"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/5/54/T--Hebrewu--insta_logo.png" width="25" height="25"></a>
 +
            <a href="https://www.igem.org/Main_Page"> <img class="social_icons" src="https://static.igem.org/mediawiki/2018/1/1a/T--Hebrewu--IGEM_logo.png" width="30"></a>  
  
−
<h3>What information do I need to start putting my parts on the Registry?</h3>
+
    </div>  
−
<p>The information needed to initially create a part on the Registry is:</p>
+
−
<ul>
+
−
<li>Part Name</li>
+
−
<li>Part type</li>
+
−
<li>Creator</li>
+
−
<li>Sequence</li>
+
−
<li>Short Description (60 characters on what the DNA does)</li>
+
−
<li>Long Description (Longer description of what the DNA does)</li>
+
−
<li>Design considerations</li>
+
−
</ul>
+
  
−
<p>
+
</ul>  
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
+
  
 +
<!----------- Responsive Navbar --------------->   
 +
<div class="huji_smallnav" id="huji_shownav">
 +
    <button class="huji_small_navbar">Project</button>
 +
        <div class="huji_small_navbar_panel">
 +
            <a href="https://2018.igem.org/Team:HebrewU/Description"><button class="b_huji_small_subnav">Description</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Model"><button class="b_huji_small_subnav">Model</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Demonstrate"><button class="b_huji_small_subnav">Results</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Parts"><button class="b_huji_small_subnav">Parts</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Software"><button class="b_huji_small_subnav">MOOLTi</button></a>
 +
        </div>
 +
 +
    <button class="huji_small_navbar">Lab</button>
 +
        <div class="huji_small_navbar_panel">
 +
            <a href="https://2018.igem.org/Team:HebrewU/Design"><button class="b_huji_small_subnav">Yeast Design</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Plant"><button class="b_huji_small_subnav">Plant Design</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Notebook"><button class="b_huji_small_subnav">Notebook</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/InterLab"><button class="b_huji_small_subnav">InterLab</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Safety"><button class="b_huji_small_subnav">Safety</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Protocols"><button class="b_huji_small_subnav">Protocols</button></a>
 +
 +
        </div>
 +
 +
    <button class="huji_small_navbar">Human Practice</button>
 +
        <div class="huji_small_navbar_panel">
 +
            <a href="https://2018.igem.org/Team:HebrewU/Human_Practices"><button class="b_huji_small_subnav">Human Practice - Main Page</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Ethics"><button class="b_huji_small_subnav">Ethics</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Global_aspects"><button class="b_huji_small_subnav">Global Aspects</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Public_Engagment"><button class="b_huji_small_subnav">Public Engagment</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Open_Source"><button class="b_huji_small_subnav">Open Source</button></a>
 +
        </div>
 +
 +
 +
     
 +
          <button class="huji_small_navbar">Team</button>
 +
        <div class="huji_small_navbar_panel">
 +
            <a href="https://2018.igem.org/Team:HebrewU/Members"><button class="b_huji_small_subnav">Members</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Attributions"><button class="b_huji_small_subnav">Attributions</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Collaborations"><button class="b_huji_small_subnav">Collaborations</button></a>
 +
            <a href="https://2018.igem.org/Team:HebrewU/Photo_Gallery"><button class="b_huji_small_subnav">Photo Gallery</button></a>
 +
        </div>
 +
       
 +
            <a href="https://2018.igem.org/Team:HebrewU/Judging"><button class="huji_small_navbar">Judging</button></a>
 
</div>
 
</div>
 +
<!----------- Script 1 for small navbar --------------->
 +
<script>
 +
        function show_small_nav() {
 +
              var x = document.getElementById("huji_shownav");
 +
            if (x.style.display === "none") {
 +
                x.style.display = "block";
 +
            } else {
 +
                x.style.display = "none";
 +
            }
 +
        }
 +
    </script>
  
 +
<!------------ Script 2 for small navbar ------------->
 +
<script>
 +
    var acc = document.getElementsByClassName("huji_small_navbar");
 +
    var i;
 +
   
 +
    for (i = 0; i < acc.length; i++) {
 +
        acc[i].addEventListener("click", function() {
 +
            this.classList.toggle("active");
 +
            var huji_small_navbar_panel = this.nextElementSibling;
 +
            if (huji_small_navbar_panel.style.display === "block") {
 +
                huji_small_navbar_panel.style.display = "none";
 +
            } else {
 +
                huji_small_navbar_panel.style.display = "block";
 +
            }
 +
        });
 +
    }
 +
    </script>
 +
   
 +
    <a onClick="topFunction()" id="myBtn_up" title="Go to top"><img src="https://static.igem.org/mediawiki/2018/1/1e/T--hebrewu--arrow_up.png" width="40px" /></a>
  
−
<div class="clear extra_space"></div>
 
−
<div class="line_divider"></div>
 
−
<div class="clear extra_space"></div>
 
  
−
<div class="column full_size">
+
<script>
−
<h3>Part Table </h3>
+
// When the user scrolls down 20px from the top of the document, show the button
 +
window.onscroll = function() {scrollFunction()};
  
−
<p>Please include a table of all the parts your team has made during your project on this page. Remember part characterization and measurement data must go on your team part pages on the Registry. </p>
+
function scrollFunction() {
 +
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
        document.getElementById("myBtn_up").style.display = "block";
 +
    } else {
 +
        document.getElementById("myBtn_up").style.display = "none";
 +
    }
 +
}
  
−
</html>
+
// When the user clicks on the button, scroll to the top of the document
−
<groupparts>iGEM18 HebrewU</groupparts>
+
function topFunction() {
−
<html>
+
    document.body.scrollTop = 0;
 +
    document.documentElement.scrollTop = 0;
 +
}
 +
</script>
 +
<!------------ HP start ------------->
 +
 
 +
<br /> <br />
 +
 
 +
<!-- Header -->
 +
            <div class="w3-center w3-animate-bottom">
 +
            <img src="https://static.igem.org/mediawiki/2018/c/c5/T--hebrewu--PARTS_HL.png" width="20%">
 +
          <br /> <br /> <br />
 +
 
 +
 
 +
<a href="#Gal_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gal 1/10</button> </a> &nbsp; &nbsp;
 +
    <a href="#Gibson_main_toggle"><button class="w3-button w3-padding-large w3-large w3-margin-top" style="background-color:#D1F2EB;border-radius: 12px;width:100px;">Gibson brick</button></a>
 +
   
 +
   
 +
<!-- Gal 1/10 Grid -->
 +
<div id="Gal_main_toggle" class="w3-container w3-content">
 +
      <h1 class="w3-center">Gal 1/10</h1> <br />
 +
      <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
              GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously.
 +
              Each complimentary strand promotes translation in opposing directions.
 +
              Galactose induces transcription, while Glucose serves as a repressor.
 +
              The promoter is inducible by as low as 2% Galactose the in medium. </p> <br />
 +
       
 +
            <div class="w3-center">
 +
            <img src="https://static.igem.org/mediawiki/2018/7/7d/T--hebrewu--parts_plasmid.png" width="50%">
 +
            </div> <br /><br /><br />
 +
          <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
 
 +
            It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits,
 +
            or can simply be used to effectively cut the number of plasmids required  for cloning in half, as two genes can be cloned into a single plasmid.<br />
 +
   
 +
            To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector,
 +
            containing two subunits of the same protein- 44a-Dioxygenase (44a).
 +
            This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS).
 +
            We used Leu2 as a regulating gene, as it is found on the same plasmid,
 +
            but its transcription is not dependent on the Gal 1/10 Promoter.<br /><br />
 +
           
 +
            We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:<br /><br />
 +
           
 +
                1. 44a- Containing the vector shown in the map above,
 +
                    with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.<br/>
 +
                2. CTRL strain, containing a similar but "empty" vector.
 +
                    This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.<br/>
 +
             
 +
        </p>
 +
        <div class="w3-center">
 +
            <img src="https://static.igem.org/mediawiki/2018/4/46/T--hebrewu--Parts_table.png" width="100%">
 +
        </div><br/>
 +
       
 +
        <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
            After growth, be split each strain into 2 treatments:<br /><br />
 +
           
 +
                1. Induced:      SG media, containing 2% galactose in the media. <br/>
 +
                2. Uninduced: SD media, containing 2% glucose in the media. <br/>
 +
         
 +
   
 +
            As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments.
 +
   
 +
            The results of this experiment are detailed in the graph below.
 +
            After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented.
 +
            <br />
 +
            <br />
 +
            In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.  <br/>
 +
            Additionally, we see approximately equal expression between the uninduced treatment and the control group,
 +
            indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification.
 +
            (We used SYBR, and not a probe, therefore the possibility of such background noise arises)
 +
        </p>
 
</div>
 
</div>
  
 +
<!-- Gibson brick Grid -->
 +
<div id="Gibson_main_toggle" class="w3-row-padding w3-padding-64 w3-container w3-content">
 +
      <h1 class="w3-center">Gibson brick</h1> <br /> 
 +
      <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
              An obstacle many team face is finding a way to assemble multiple genetic components into a single
 +
              plasmid effectively and quickly. Though the biobrick standard addresses this issue,
 +
              we found that using newer, more advanced methods of can help save time and resources.
 +
              We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction
 +
              is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful.
 +
  Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector.
 +
  This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment.
 +
              Each of our oligos is approximately 40 Bp long, consisting of two components:<br /><br />
 +
             
 +
                   
 +
                    1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
 +
                    <br />
 +
                   
 +
                    2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly.
 +
                    <br /><br />
 +
             
 +
  This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction
 +
              stitch them all together into a plasmid, ready for transformation. </p>
 +
       
 +
            <div class="w3-center">
 +
            <img src="https://static.igem.org/mediawiki/2018/6/64/T--HebrewU--GibsonBricksmall.png" width="60%">
 +
            </div> <br /><br /><br />
 +
            <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
            Parts in Registry: <br /> <br />
 +
   
 +
<table class="w3-table w3-striped w3-white" style="color:black;">
 +
            <tr>
 +
                <th>
 +
                <strong>BioBrick</strong>
 +
                </th>
 +
                <th>
 +
                <strong>Name</strong>
 +
                </th>
 +
                <th>
 +
                <strong>Sequence</strong>
 +
                </th>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667002
 +
                </td>
 +
                <td>
 +
                GibsonBrick 1 Fw
 +
                </td>
 +
                <td>
 +
                GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667003
 +
                </td>
 +
                <td>
 +
                GibsonBrick 1 Rv
 +
                </td>
 +
                <td>
 +
                TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667004
 +
                </td>
 +
                <td>
 +
                GibsonBrick 2 Fw
 +
                </td>
 +
                <td>
 +
                CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667005
 +
                </td>
 +
                <td>
 +
                GibsonBrick 2 Rv
 +
                </td>
 +
                <td>
 +
                TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667006
 +
                </td>
 +
                <td>
 +
                GibsonBrick 3 Fw
 +
                </td>
 +
                <td>
 +
                CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667007
 +
                </td>
 +
                <td>
 +
                GibsonBrick 3 Rv
 +
                </td>
 +
                <td>
 +
                TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667008
 +
                </td>
 +
                <td>
 +
                GibsonBrick 4 Fw
 +
                </td>
 +
                <td>
 +
                TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG
 +
                </td>
 +
            </tr>
 +
            <tr>
 +
                <td>
 +
                BBa_K2667009
 +
                </td>
 +
                <td>
 +
                GibsonBrick 4 Rv
 +
                </td>
 +
                <td>
 +
                TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG
 +
                </td>
 +
            </tr>
 +
</table>
 +
           
 +
            <br /> <br />
 +
            <p class="w3-justify" style="padding-right:30px;padding-left:30px;">
 +
 +
            Fragments should be amplified in the following order: <br /><br />
 +
           
 +
                Fragment 1: Custom Vector Primer 1 +  GibsonBrick 1 Rv.<br/>
 +
                    Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv. <br/>
 +
                    Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv. <br/>
 +
                    Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv. <br/>
 +
                    Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.<br/><br/>
 +
               
 +
               
 +
                The Custom vector primers should contain the Prefix and Suffix respectively, along with
 +
                homologous regions that will allow for assembly with the Vector your team is using. </p><br/>
 +
 +
</div>
  
  
  
 +
</body>
 
</html>
 
</html>

Latest revision as of 17:30, 12 December 2018

HebrewU HujiGEM 2018






   

Gal 1/10


GAL 1- GAL 10 is a divergent promoter region of Saccharomyces cerevisiae, allowing it to regulate two genes simultaneously. Each complimentary strand promotes translation in opposing directions. Galactose induces transcription, while Glucose serves as a repressor. The promoter is inducible by as low as 2% Galactose the in medium.





It is particularly useful for measuring protein-protein interactions, expressing proteins with two subunits, or can simply be used to effectively cut the number of plasmids required for cloning in half, as two genes can be cloned into a single plasmid.
To validate this part we performed Real-Time PCR on yeast with our Leu-44a vector, containing two subunits of the same protein- 44a-Dioxygenase (44a). This enzyme contains to subunits: 44a Large Subunit (LS) and 44a Small Subunit (SS). We used Leu2 as a regulating gene, as it is found on the same plasmid, but its transcription is not dependent on the Gal 1/10 Promoter.

We grew 2 strains of yeast in SD media (containing glucose) for 36 hours. The strains were as follows:

1. 44a- Containing the vector shown in the map above, with the LS transcription being promoted by Gal 10 and SS transcription being promoted by Gal1.
2. CTRL strain, containing a similar but "empty" vector. This vector also contains the Leu2 gene, and Gal 1/10 promoters, but does not have the 44a genes inserted.


After growth, be split each strain into 2 treatments:

1. Induced: SG media, containing 2% galactose in the media.
2. Uninduced: SD media, containing 2% glucose in the media.
As the primers for the RT-PCR are gene specific to the subunits, we expected to see no product in the CTRL vectors, in both treatments. The results of this experiment are detailed in the graph below. After normalizing the raw expression data of our target genes to the expression of the Leu2 gene, we get the figures presented.

In the induced treatment, we see expression rise more than 20 fold over the uninduced treatment.
Additionally, we see approximately equal expression between the uninduced treatment and the control group, indicating the minor levels could be background noise caused by the non-specificity of primers, or primer-dimer amplification. (We used SYBR, and not a probe, therefore the possibility of such background noise arises)

Gibson brick


An obstacle many team face is finding a way to assemble multiple genetic components into a single plasmid effectively and quickly. Though the biobrick standard addresses this issue, we found that using newer, more advanced methods of can help save time and resources. We, as many iGEM teams before us, decided to use Gibson Assembly. Since no restriction is required for this method, the multi-cloning sites in the biobrick prefix and suffix were not particularly helpful. Gibson Assembly utilizes homologous overlaps on each DNA fragment allowed for their cloning into a single vector. This set of 8 oligos, that help to convert any biobrick into a Gibson Assembly ready fragment. Each of our oligos is approximately 40 Bp long, consisting of two components:

1. Biobrick prefix/suffix region- allowing them to be used as primers for any (RFC10) biobricks currently in the iGEM library.
2. 20 bp region with no secondary structures and about 50% GC content, allowing for extremely efficient Gibson Assembly.

This means that teams can, in one PCR, clone all their biobricks with these 20 bp overlaps, and then in one Gibson reaction stitch them all together into a plasmid, ready for transformation.




Parts in Registry:

BioBrick Name Sequence
BBa_K2667002 GibsonBrick 1 Fw GCACTGAAGGTCCTCAATCGCGAATTCGCGGCCGCTTCTAG
BBa_K2667003 GibsonBrick 1 Rv TACTAGTAGCGGCCGCTGCAGGCACTGAAGGTCCTCAATCGC
BBa_K2667004 GibsonBrick 2 Fw CTGACCTCCTGCCAGCAATAGGAATTCGCGGCCGCTTCTAG
BBa_K2667005 GibsonBrick 2 Rv TACTAGTAGCGGCCGCTGCAGCTGACCTCCTGCCAGCAATAG
BBa_K2667006 GibsonBrick 3 Fw CTATTGCTGGCAGGAGGTCAGGAATTCGCGGCCGCTTCTAG
BBa_K2667007 GibsonBrick 3 Rv TACTAGTAGCGGCCGCTGCAGCTATTGCTGGCAGGAGGTCAG
BBa_K2667008 GibsonBrick 4 Fw TCTTAGGTGGCAGCGAACGAGGAATTCGCGGCCGCTTCTAG
BBa_K2667009 GibsonBrick 4 Rv TACTAGTAGCGGCCGCTGCAGTCTTAGGTGGCAGCGAACGAG


Fragments should be amplified in the following order:

Fragment 1: Custom Vector Primer 1 + GibsonBrick 1 Rv.
Fragment 2: GibsonBrick 1 Fw + GibsonBrick 2 Rv.
Fragment 3: GibsonBrick 2 Fw + GibsonBrick 3 Rv.
Fragment 4: GibsonBrick 3 Fw + GibsonBrick 4 Rv.
Fragment 5: GibsonBrick 4 Fw + Custom Vector Primer 2.

The Custom vector primers should contain the Prefix and Suffix respectively, along with homologous regions that will allow for assembly with the Vector your team is using.