Difference between revisions of "Team:HSHL/Design"
AntoniaShm (Talk | contribs) m |
AntoniaShm (Talk | contribs) m |
||
| Line 145: | Line 145: | ||
All four fragments will bind together because of the different restriction sites. For example, the end of the first fragment and the beginning of the second fragment have the same restriction site. This means only one end fits the other end. | All four fragments will bind together because of the different restriction sites. For example, the end of the first fragment and the beginning of the second fragment have the same restriction site. This means only one end fits the other end. | ||
</p> | </p> | ||
| + | </div> | ||
| + | |||
| + | <div class="column third_size"> | ||
| + | <p><b>1. fragment</b></p> | ||
| + | <p>Length: 614 bp</p> | ||
| + | <p></p> | ||
| + | |||
| + | <p><b>Restriction enzymes</b></p> | ||
| + | <p>EcoRI: <span class="highlightYellow">G/AATTC</span> <br> | ||
| + | HindIII: <span class="highlightRed">A/AGCTT </span> <br> | ||
| + | <span class="highlightDarkBlue">GA<span class="highlightRed">G</span>TTC</span> = changed codon to make sure that EcoRI will not cut several times</p> | ||
| + | </div> | ||
| + | |||
| + | <div class="column two_thirds_size"> | ||
| + | <div class="highlight decoration_background"> | ||
| + | <p> <span class="monospace"> | ||
| + | |||
| + | </p> | ||
| + | </span> | ||
| + | </div> | ||
</div> | </div> | ||
Revision as of 08:19, 11 October 2018
Design
1st idea - Working with the whole sequence
The HMA3 Sequence is with 2619 bp quite big which make it a little bit difficult for us to actually isolate this sequence out of the A. halleri. That is the reason why we decided to get it synthesized by IDT.
First option was to use the whole sequence (2631 bp). A CaMV 35S (universal promoter, Cauliflower Mosaic Virus) is used as a promoter with a length of 345 bp.
For our Biobrick we decided to use the Vector called pSB1C3 with a chloramphenicol resistance. By including the sequence of the restriction sites of EcoRI at the beginning and PstI at the end of our sequence, which are the same restriction sites for the plasmide, we can insert our sequence into our targeted vector. In our specific case EcoRI would cut about two times into our Gene HMA3 for example. To make sure the restriction enzyme will not cut several times into our sequence we had to change some codons in the original sequence of our Gene HMA3 (you can see the changes of the codons below in red).
| sequence | length [bp] | color |
|---|---|---|
| CaMV 35S promoter | 245 | letters |
| AhHMA3 cDNA | 2.274 | highlighted |
| restriction site of EcoRI (G/AATTC) | 6 | highlighted |
| restriction site of PstI (CTGCA/G) | 6 | highlighted |
| whole sequence | 2.613 |
Promoter and gene sequence
In the following the whole promoter and gene sequence including the restriction sites to ligate into the vector pSB1C3 is shown.
GAGTTC = changed codon to make sure that EcoRI will not cut several times
GAATTCTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCA TCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGC ACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAATGGCGGAAGGTGAAGAGGCCAAGAAGAAGAATTTACAGACAAGTTACTTCGACGTCGTTGGAATCTGCTGTACATCG GAGGTTTCTATCGTCGGTGACGTTCTCCGTCCACTTGACGGCGTCAAAGAGTTCTCCGTTATCGTCCCTTCTAGAACCGTCATCGTTGTCCATGACACTTTCTTGATTTCTCCGCTTCAAATCGTCAAGGCTCTGAATCAAGC AAGACTAGAAGCAAGTGTGAGACCATACGGAGAAACAAGCTTGAAGAGTCAATGGCCAAGTCCTTTTGCAATACTTTCTGGGGTATTTCTTGCTCTCTCCTTCTTCAAATACTTTTATAGTCTGCTTGAATGGCTCGCTGTTG TTGCCGTGGTGGCCGGGATTTTCCCCATCCTTGCTAAAGCTGTTGCTTCGGTCACAAGGTTCAGACTTGATATCAACGCTCTCACTTTTATTGCTGTGATAGCAACACTATGTATGCAGAATTTCACAGAAGCTGCCACAATT GTGTTTCTATTCTCAGTTGCAGATTGGCTAGAGTCTAGTGCTGCTCATAAGGCAAGCACAGTAATGTCATCACTGATGAGCTTAGCGCCACGAAAGGCAGTGATAGCGGAAACTGGACACGAAGTCGATGTAGATGAGGTTAG GATCAACACAATTGTTTCAGTGAAAGCTGGAGAAAGTATACCGATTGATGGAGTTGTGGTGGATGGAAGCTGTGATGTGGATGAGAAAACATTGACAGGAGAGTCATTCCCTGTCTCCAAACAGAGAGATTCAACTGTTTTGG CTGCAACCATAAATCTTAATGGTTATATAAAGGTGAAAACTACAGCTCTAGCCCGGGACTGCGTAGTCGCGAAAATGACTAAGCTTGTAGAAGAAGCTCAAAAAAGCCAAACCAAAACTCAAAGGTTTATAGATAAATGTTCT CGCTACTACACTCCAGCTGTTGTCGTGTTAGCAGCATGTTTTGCGGTGATCCCGGTATTGTTAAAGCTTCAGGACCTTAGCCATTGGTTTCACTTAGCACTTGTAGTGTTAGTAAGTGGTTGTCCATGTGGTCTTATCTTATC CACACCTATTGCTACCTTTTGTGCTCTCACTAAGGCAGCCATGTCGGGGTTTCTGATCAAAACTGGTGATTGTCTAGAGACTCTTGCAAAGATCAAGATTGTTGCTTTTGACAAAACAGGAACTATTACAAAGGCTGAGTTCA TGGTCTCGGATTTTAGGTCTCTTTCTCACAATATCAATCTGCACAACTTGCTTTACTGGGTCTCGAGCATTGAGAGCAAGTCAAGTCATCCGATGGCAGCGGCGCTTATTGACTATGCAAGATCAGTTTCTGTTGAGCCTAAG CCTGATCTCGTTGAGAACTTTCAAAACTTTCCAGGAGAAGGAGTTTATGGGAGAATAGATGGTCAAGATATCTACATTGGAAACAAAAGAATTGCACAGAGAGCTGGATGCTTAACAGTTCCGGATATGGAAGCTAATATGAA GCGAGGTAAGACCATTGGTTACATATACATTGGAGCAAAACTGTCCGGAAGTTTCAACCTTATTGACAGTTGTCGATATGGGGTTGCTCAAGCTCTCAAGGAGCTCAAGTCTTTAGGAATCAAAACTGCAATGCTCACAGGAG ATAACCGAGACGCAGCCCTGTCTACTCAAGAACAGTTAGAGAATGCTTTGGATATTGTTCACTCTGAACTCCTTCCACAAGACAAAGCAAGAATCATCGATGAGTTCAAGATCCAAGGGCCTACAATGATGGTAGGAGACGGG CTTAACGATGCACCGGCTTTAGCGAAAGCAGACATTGGCCTTTCAATGGGGATCTCAGGGTCAGCACTTGCAACAGAGACAGGAGACATCATTCTTATGTCAAACGATATAAGGAAGATCCCGAAAGGGATGAGACTAGCGAA GAGAAGTCATAAGAAAGTGATTGAGAATGTTGTTTTGTCTGTGAGCATAAAAGGAGCAATCATGGTTCTTGCTTTTGTAGGTTACCCTCTGGTTTGGGCAGCTGTACTTGCAGATGCAGGAACTTGTTTGCTTGTGATACTCA ATAGTATGATGCTTCTACGCGATGAGCGTGAAGCCGTGTCTACATGTTACCGTGCTTCTTCTTCGCCGGTGAAACTTGAGGAGGATGAAGCAGAGGATCTAGAAGTTGGCTTGTTGCAGAAGAGTGAGGAGACAAATAAAAAG AGTTGTTGCTCTGGTTCTTGTAGTGGCCCTAAGGACAATCAACAAAAGTGACTGCAG
2nd idea - Separating the sequence into 4 parts
The second option is to separate our whole promoter and gene sequence in 4 fragment parts. You can see the parts in the table below.
| Restriction site at the | |||||
| Sequence | Length [bp] | beginning of the sequence | end of the sequence | ||
|---|---|---|---|---|---|
| IDT 1. Part sequence |
614 | EcorRI: G/AATTC | HindIII: A/AGCTT | ||
| IDT 2. Part sequence |
593 | HindIII: A/AGCTT | SmaI: CCC/GGG; blunt end | ||
| IDT 3. Part sequence |
556 | SmaI: CCC/GGG; blunt end | EcoRII: -/CCWGG; W=A/T | ||
| IDT 4. Part sequence |
885 | EcoRII: -/CCWGG; W=A/T | PstI: CTGCA/G | ||
| Total length of the synthesized fragments | 2.648 | ||||
| Length of the sequence after the ligation | 2.613 | ||||
The following part shows the 4 fragments, which were synthesized by the IDT. The black letters indicates the promoter sequence and the green letters the HMA3 gene sequence. The restriction sites for each restriction enzyme are highlighted in different colors to clearly differentiate inbetween them. To ligate these fragments into the vector pSB1C3, the first fragment needs to have the restriction site of EcoRI at the beginning as well as the fourth fragment needs to end with the restriction site of PstI. For this sequence design, we also have to changed a few codons to make sure that EcoRI and HindIII will not cut several times in the sequence. All four fragments will bind together because of the different restriction sites. For example, the end of the first fragment and the beginning of the second fragment have the same restriction site. This means only one end fits the other end.
1. fragment
Length: 614 bp
Restriction enzymes
EcoRI: G/AATTC
HindIII: A/AGCTT
GAGTTC = changed codon to make sure that EcoRI will not cut several times
Instagram | Twitter | University | Fundraiser | E-Mail